Incidental Mutation 'R8516:Cldn15'
ID 656142
Institutional Source Beutler Lab
Gene Symbol Cldn15
Ensembl Gene ENSMUSG00000001739
Gene Name claudin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 136966616-136975858 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 136974696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 184 (C184F)
Ref Sequence ENSEMBL: ENSMUSP00000001790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000111093]
AlphaFold Q9Z0S5
PDB Structure Crystal structure of mouse claudin-15 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001790
AA Change: C184F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739
AA Change: C184F

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111093
AA Change: C184F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739
AA Change: C184F

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein increases permeability for sodium ions in anion-selective epithelial cell sheets. The gene deficiency leads to megaintestine and decreases in intestinal epithelial paracellular ion permeability. This gene is a direct target for hepatocyte-nuclear-factor-4alpha, a mediator of ion epithelial transport, and is down-modulated in inflammatory bowel disease. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grow normally with an enlarged upper small intestinal phenotype (megaintestine) resulting from enhanced proliferation of normal cryptic cells after weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Cldn15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Cldn15 APN 5 136974831 missense probably benign 0.00
R0395:Cldn15 UTSW 5 136968198 missense possibly damaging 0.91
R2112:Cldn15 UTSW 5 136968162 missense possibly damaging 0.93
R4647:Cldn15 UTSW 5 136974483 missense probably damaging 1.00
R6383:Cldn15 UTSW 5 136968125 missense probably benign 0.07
R6576:Cldn15 UTSW 5 136974616 missense probably damaging 1.00
R6596:Cldn15 UTSW 5 136974679 nonsense probably null
R7285:Cldn15 UTSW 5 136972473 missense probably benign 0.01
R7721:Cldn15 UTSW 5 136968161 missense probably benign 0.21
R7956:Cldn15 UTSW 5 136974650 missense probably damaging 1.00
R8796:Cldn15 UTSW 5 136974497 missense probably damaging 1.00
R9356:Cldn15 UTSW 5 136968114 missense probably benign 0.08
R9407:Cldn15 UTSW 5 136974911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACTGTATGCTGGAACC -3'
(R):5'- TTTGCCATATTTACCGAAGCTG -3'

Sequencing Primer
(F):5'- CCACTGTATGCTGGAACCAAGTAAG -3'
(R):5'- GAAGCTGATGTCACTCTCATCCGAG -3'
Posted On 2020-10-20