Incidental Mutation 'R8516:Hap1'
ID 656166
Institutional Source Beutler Lab
Gene Symbol Hap1
Ensembl Gene ENSMUSG00000006930
Gene Name huntingtin-associated protein 1
Synonyms HAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100347327-100356128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100356067 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 4 (K4R)
Ref Sequence ENSEMBL: ENSMUSP00000099413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103124] [ENSMUST00000138603] [ENSMUST00000146878] [ENSMUST00000174635]
AlphaFold O35668
Predicted Effect possibly damaging
Transcript: ENSMUST00000103124
AA Change: K4R

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099413
Gene: ENSMUSG00000006930
AA Change: K4R

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 79 403 5e-111 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138603
AA Change: K4R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133356
Gene: ENSMUSG00000006930
AA Change: K4R

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 80 402 1.4e-109 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146878
SMART Domains Protein: ENSMUSP00000134625
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 181 2.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173630
SMART Domains Protein: ENSMUSP00000134050
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 177 1e-46 PFAM
low complexity region 250 268 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174635
SMART Domains Protein: ENSMUSP00000133831
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 119 137 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene was first identified as a neuronal protein that binds the HD protein huntingtin. The protein also interacts with kinesin light chain, 14-3-3 proteins, and Abelson helper integration site 1 protein. The protein is involved in intracellular trafficking of vesicles and organelles, and lack of the protein results in neuronal death resembling the hypothalamic degeneration that occurs in Huntington's disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal feeding and/or suckling behavior, absent gastric milk in neonates, slow postnatal weight gain, and postnatal death. Degeneration in hypothalamic regions that control feeding behavior has been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Hap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Hap1 APN 11 100349548 missense probably benign 0.00
IGL01320:Hap1 APN 11 100349380 missense probably damaging 0.96
IGL01790:Hap1 APN 11 100351906 splice site probably null
IGL01949:Hap1 APN 11 100348762 missense probably damaging 0.96
IGL02325:Hap1 APN 11 100354364 critical splice acceptor site probably null
IGL03399:Hap1 APN 11 100354267 missense possibly damaging 0.90
R0346:Hap1 UTSW 11 100356029 missense probably benign
R0463:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R0608:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R1112:Hap1 UTSW 11 100354317 missense probably damaging 1.00
R1682:Hap1 UTSW 11 100349476 missense possibly damaging 0.46
R1952:Hap1 UTSW 11 100352279 missense probably damaging 1.00
R2079:Hap1 UTSW 11 100353746 missense probably damaging 1.00
R2088:Hap1 UTSW 11 100356002 missense probably benign
R2112:Hap1 UTSW 11 100353999 missense probably benign 0.28
R2211:Hap1 UTSW 11 100354724 missense probably benign 0.21
R2354:Hap1 UTSW 11 100354715 missense probably damaging 1.00
R3829:Hap1 UTSW 11 100356021 missense probably damaging 0.99
R4259:Hap1 UTSW 11 100351842 critical splice donor site probably null
R4429:Hap1 UTSW 11 100354272 missense probably benign 0.00
R4585:Hap1 UTSW 11 100354724 missense probably benign 0.21
R4586:Hap1 UTSW 11 100354724 missense probably benign 0.21
R5085:Hap1 UTSW 11 100355711 missense probably damaging 1.00
R5133:Hap1 UTSW 11 100351531 missense probably benign 0.00
R5762:Hap1 UTSW 11 100355774 missense probably damaging 1.00
R6118:Hap1 UTSW 11 100355794 missense probably benign 0.24
R6148:Hap1 UTSW 11 100349392 missense probably damaging 1.00
R7221:Hap1 UTSW 11 100348829 missense probably benign 0.02
R7683:Hap1 UTSW 11 100351548 missense probably damaging 1.00
R8350:Hap1 UTSW 11 100349281 missense probably damaging 0.96
R8450:Hap1 UTSW 11 100349281 missense probably damaging 0.96
R8855:Hap1 UTSW 11 100356038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTCCTGTCTTGGTTCG -3'
(R):5'- CCACGGAATAAGCTAGGCAC -3'

Sequencing Primer
(F):5'- CCTGTCTTGGTTCGGGATCC -3'
(R):5'- AGGCACTAGTTCATCTCTTTCTTTC -3'
Posted On 2020-10-20