Incidental Mutation 'R8516:Olfr692'
ID 656151
Institutional Source Beutler Lab
Gene Symbol Olfr692
Ensembl Gene ENSMUSG00000073906
Gene Name olfactory receptor 692
Synonyms GA_x6K02T2PBJ9-7994144-7995106, MOR36-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 105368230-105369355 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105368769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 148 (I148V)
Ref Sequence ENSEMBL: ENSMUSP00000151295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098152] [ENSMUST00000179474] [ENSMUST00000217827]
AlphaFold Q8VF03
Predicted Effect probably benign
Transcript: ENSMUST00000098152
AA Change: I139V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095755
Gene: ENSMUSG00000073906
AA Change: I139V

DomainStartEndE-ValueType
Pfam:7tm_4 45 325 1.3e-90 PFAM
Pfam:7TM_GPCR_Srsx 49 233 1.3e-7 PFAM
Pfam:7tm_1 55 307 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179474
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217827
AA Change: I148V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Olfr692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Olfr692 APN 7 105369247 missense probably damaging 1.00
IGL01772:Olfr692 APN 7 105368434 missense probably benign 0.03
IGL02508:Olfr692 APN 7 105368536 missense possibly damaging 0.95
IGL03103:Olfr692 APN 7 105368578 missense probably damaging 1.00
R1147:Olfr692 UTSW 7 105369277 missense probably benign 0.14
R1147:Olfr692 UTSW 7 105369277 missense probably benign 0.14
R5237:Olfr692 UTSW 7 105369306 nonsense probably null
R5294:Olfr692 UTSW 7 105368413 missense probably benign 0.41
R5955:Olfr692 UTSW 7 105368569 missense probably damaging 1.00
R6321:Olfr692 UTSW 7 105368902 missense probably damaging 1.00
R7171:Olfr692 UTSW 7 105368761 missense probably benign 0.02
R7284:Olfr692 UTSW 7 105368545 missense probably damaging 0.98
R8376:Olfr692 UTSW 7 105368640 missense probably benign 0.33
R9054:Olfr692 UTSW 7 105368473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTAGCCACATCTATAGCCC -3'
(R):5'- AGCCAGTGAAAGTGCTAGCC -3'

Sequencing Primer
(F):5'- ACATCTATAGCCCCAGAGTTGCTG -3'
(R):5'- AGTGCTAGCCCATACATGTTG -3'
Posted On 2020-10-20