Incidental Mutation 'R8516:Trim2'
ID 656128
Institutional Source Beutler Lab
Gene Symbol Trim2
Ensembl Gene ENSMUSG00000027993
Gene Name tripartite motif-containing 2
Synonyms neural activity-related ring finger protein, narf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 84160439-84306877 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84208320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 102 (A102T)
Ref Sequence ENSEMBL: ENSMUSP00000049902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054990] [ENSMUST00000065380] [ENSMUST00000107691] [ENSMUST00000107692] [ENSMUST00000107693] [ENSMUST00000107695] [ENSMUST00000122849] [ENSMUST00000132283] [ENSMUST00000147901] [ENSMUST00000154152]
AlphaFold Q9ESN6
Predicted Effect probably damaging
Transcript: ENSMUST00000054990
AA Change: A102T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049902
Gene: ENSMUSG00000027993
AA Change: A102T

DomainStartEndE-ValueType
RING 49 89 3.5e-9 SMART
BBOX 139 180 3.52e-14 SMART
BBC 187 313 1.7e-38 SMART
IG_FLMN 350 450 2.41e-30 SMART
Pfam:NHL 512 539 2e-8 PFAM
Pfam:NHL 559 586 1.1e-8 PFAM
Pfam:NHL 601 628 2.1e-7 PFAM
Pfam:NHL 648 675 5.8e-10 PFAM
Pfam:NHL 695 722 3.5e-12 PFAM
Pfam:NHL 739 766 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065380
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069922
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107691
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103319
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107692
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103320
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107693
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103321
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107695
AA Change: A93T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103323
Gene: ENSMUSG00000027993
AA Change: A93T

DomainStartEndE-ValueType
RING 40 80 3.5e-9 SMART
BBOX 130 171 3.52e-14 SMART
BBC 178 304 1.7e-38 SMART
IG_FLMN 341 441 2.41e-30 SMART
Pfam:NHL 503 530 9.1e-8 PFAM
Pfam:NHL 550 577 7.5e-8 PFAM
Pfam:NHL 592 619 1.2e-6 PFAM
Pfam:NHL 639 666 6.3e-9 PFAM
Pfam:NHL 686 713 4.7e-12 PFAM
Pfam:NHL 730 757 5.8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122849
AA Change: A94T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120981
Gene: ENSMUSG00000027993
AA Change: A94T

DomainStartEndE-ValueType
RING 41 81 3.5e-9 SMART
BBOX 131 172 3.52e-14 SMART
Blast:BBC 179 213 3e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132283
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118888
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
Blast:BBC 161 191 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000147901
AA Change: A76T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121055
Gene: ENSMUSG00000027993
AA Change: A76T

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154152
SMART Domains Protein: ENSMUSP00000115914
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 39 70 9.3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit tremors, ataxia and seizures associated with neurodegeneration of Purkinje cells, deep cerebellar nuclei and retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Trim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trim2 APN 3 84208289 missense probably damaging 1.00
IGL01658:Trim2 APN 3 84210285 missense probably benign 0.33
IGL02943:Trim2 APN 3 84178176 missense probably benign 0.45
PIT4142001:Trim2 UTSW 3 84190857 missense probably benign 0.00
R0149:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R0158:Trim2 UTSW 3 84210169 splice site probably benign
R0361:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R1270:Trim2 UTSW 3 84167677 missense probably damaging 1.00
R1651:Trim2 UTSW 3 84167650 critical splice donor site probably null
R1756:Trim2 UTSW 3 84190800 missense possibly damaging 0.52
R1938:Trim2 UTSW 3 84177792 missense possibly damaging 0.94
R2046:Trim2 UTSW 3 84208289 missense probably damaging 1.00
R2192:Trim2 UTSW 3 84190918 nonsense probably null
R3696:Trim2 UTSW 3 84190851 missense probably benign 0.05
R4981:Trim2 UTSW 3 84177735 missense probably damaging 1.00
R5389:Trim2 UTSW 3 84167653 missense probably null 0.60
R5735:Trim2 UTSW 3 84167722 missense probably damaging 1.00
R7228:Trim2 UTSW 3 84192181 missense probably benign 0.01
R7297:Trim2 UTSW 3 84210233 missense probably damaging 1.00
R7640:Trim2 UTSW 3 84190906 missense probably benign 0.07
R7853:Trim2 UTSW 3 84305230 splice site probably benign
R7993:Trim2 UTSW 3 84190719 missense probably damaging 1.00
R8205:Trim2 UTSW 3 84193339 missense probably damaging 1.00
R9056:Trim2 UTSW 3 84172821 missense probably damaging 1.00
X0065:Trim2 UTSW 3 84165173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAGAATCTCTGAGGTATCCAAAGC -3'
(R):5'- CGTTGTCAGCACATCACTGATG -3'

Sequencing Primer
(F):5'- TCTGAGGTATCCAAAGCCCTCC -3'
(R):5'- GTTGTCAGCACATCACTGATGAGAAC -3'
Posted On 2020-10-20