Incidental Mutation 'R8671:4930467E23Rik'
ID 661164
Institutional Source Beutler Lab
Gene Symbol 4930467E23Rik
Ensembl Gene ENSMUSG00000096265
Gene Name RIKEN cDNA 4930467E23 gene
Synonyms ENSMUSG00000074453, OTTMUSG00000018948, TSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R8671 (G1)
Quality Score 101.008
Status Not validated
Chromosome 8
Chromosomal Location 19729576-19753527 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 19734759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 203 (L203*)
Ref Sequence ENSEMBL: ENSMUSP00000096508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098909]
AlphaFold D3Z1P8
Predicted Effect probably null
Transcript: ENSMUST00000098909
AA Change: L203*
SMART Domains Protein: ENSMUSP00000096508
Gene: ENSMUSG00000096265
AA Change: L203*

DomainStartEndE-ValueType
ANK 84 113 9.41e-6 SMART
ANK 117 146 1.48e-3 SMART
ANK 150 179 6.76e-7 SMART
ANK 183 212 1.4e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in 4930467E23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:4930467E23Rik APN 8 19749483 splice site probably benign
IGL02318:4930467E23Rik APN 8 19747799 critical splice donor site probably null
IGL03356:4930467E23Rik APN 8 19749447 missense probably benign 0.03
R5538:4930467E23Rik UTSW 8 19749414 critical splice acceptor site probably null
R6790:4930467E23Rik UTSW 8 19729785 missense probably benign
R8235:4930467E23Rik UTSW 8 19749460 missense probably benign 0.01
R9470:4930467E23Rik UTSW 8 19747793 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGTGTGGGAAAGTTCAGCAG -3'
(R):5'- GGCAGTGATCCTTAATGCATGC -3'

Sequencing Primer
(F):5'- CAGCAGGTGTTGTAGGATGAATGATC -3'
(R):5'- AGTGATCCTTAATGCATGCTGTTC -3'
Posted On 2021-03-08