Incidental Mutation 'R8728:Cyp2c67'
ID 662617
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8728 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 39608842-39649051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39626161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 307 (R307S)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: R307S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: R307S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,312 T514A probably benign Het
Adam2 A G 14: 66,057,637 L253P probably damaging Het
Adamts20 C T 15: 94,331,400 G946D probably benign Het
Afdn A G 17: 13,898,945 R1648G probably damaging Het
Ak9 G A 10: 41,406,963 A1242T Het
Anxa9 T C 3: 95,302,668 K127E probably damaging Het
Atp6v0a2 T C 5: 124,719,088 S739P probably benign Het
Bloc1s6 A T 2: 122,746,106 M122L possibly damaging Het
Bms1 A G 6: 118,392,370 I990T possibly damaging Het
Cdk14 G A 5: 5,420,117 silent Het
Celsr3 T C 9: 108,846,741 L2899S probably benign Het
Ces1b A T 8: 93,071,948 D203E probably benign Het
Cnnm1 A G 19: 43,484,926 N753S probably benign Het
Col19a1 C T 1: 24,326,032 G501R probably damaging Het
Cym A G 3: 107,218,675 F91L possibly damaging Het
Cyp3a59 G A 5: 146,098,312 probably null Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dagla G A 19: 10,248,407 R798C probably damaging Het
Dcaf1 C T 9: 106,846,806 R478C possibly damaging Het
Dcbld1 T C 10: 52,233,833 L28P probably benign Het
Ddr2 T C 1: 170,001,983 D234G possibly damaging Het
Fam83a T A 15: 58,009,666 M297K possibly damaging Het
Galnt18 T A 7: 111,520,036 D426V probably damaging Het
Gm10093 A G 17: 78,492,903 K441R probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 T C 5: 105,290,927 I32V probably benign Het
Gm9944 T C 4: 144,453,031 Y96C unknown Het
Impdh2 C T 9: 108,560,363 probably benign Het
Iws1 G A 18: 32,083,281 R358Q probably damaging Het
Kctd18 G T 1: 57,963,130 D179E probably damaging Het
Krt13 T G 11: 100,121,492 S2R probably null Het
Krt78 A T 15: 101,947,790 S529T probably benign Het
Krtap4-7 C G 11: 99,643,962 C25S unknown Het
Lama1 T C 17: 67,818,668 I2940T Het
Lmnb2 A G 10: 80,905,079 probably null Het
Lrrc27 A T 7: 139,242,639 E482V probably damaging Het
Lrrc72 G A 12: 36,208,657 T67M probably benign Het
Malrd1 T A 2: 15,696,942 C789* probably null Het
Mei1 T G 15: 82,081,981 V268G Het
Mical3 C A 6: 120,973,553 A966S probably damaging Het
Mmp10 C T 9: 7,502,479 P29L probably benign Het
Mroh2b T C 15: 4,905,640 F186L probably damaging Het
Muc4 A T 16: 32,754,952 T1609S unknown Het
Myrfl A T 10: 116,798,640 C616* probably null Het
Ncor1 C T 11: 62,330,859 A946T probably benign Het
Olfr122 C A 17: 37,771,751 L33M probably damaging Het
Olfr330 T C 11: 58,529,201 T262A probably benign Het
Pbp2 T C 6: 135,310,106 Y81C probably benign Het
Plekhh1 C A 12: 79,069,088 Q802K possibly damaging Het
Pnldc1 A T 17: 12,897,278 F279Y probably damaging Het
Psmb5 A T 14: 54,617,804 L63Q probably damaging Het
Rasa3 C T 8: 13,586,873 probably null Het
Rbm4b G A 19: 4,762,191 M209I probably benign Het
Rnf38 A G 4: 44,131,615 S421P probably benign Het
Sema5a T C 15: 32,562,557 V238A probably damaging Het
Sesn1 G T 10: 41,903,775 G402W probably damaging Het
Six4 A G 12: 73,112,406 V260A probably benign Het
Srrm2 G A 17: 23,819,857 R1825Q unknown Het
Stat1 G A 1: 52,139,194 W262* probably null Het
Tcf20 A T 15: 82,854,957 D764E probably damaging Het
Tgm2 T C 2: 158,120,145 N585D probably benign Het
Tmf1 A T 6: 97,156,860 L1039H probably damaging Het
Trak2 A G 1: 58,935,775 V86A probably benign Het
Ttc39b A G 4: 83,253,010 I202T probably damaging Het
Uhrf1bp1l A T 10: 89,782,720 M274L probably benign Het
Vmn1r30 A G 6: 58,435,475 F124S probably benign Het
Vwa7 T A 17: 35,017,157 F29Y probably damaging Het
Wdr64 A T 1: 175,731,513 M281L probably benign Het
Zfand2a C T 5: 139,481,998 V40M possibly damaging Het
Zfp865 G C 7: 5,031,820 A935P probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39638711 missense probably benign 0.05
R9275:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39638734 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTTTTCAACTGCTCAGGTATC -3'
(R):5'- CTACACCACAGTCTCTGAAATGG -3'

Sequencing Primer
(F):5'- CAACTGCTCAGGTATCTTCATTTAC -3'
(R):5'- GCCACTGATGAACATTTTAGATTCTG -3'
Posted On 2021-03-08