Mutagenetix > Incidental Mutation

Incidental Mutation 'R8874:Strc'

676454

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R8874 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 121374872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably null
Transcript: ENSMUST00000038389

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	A	G	5: 8,825,671	M615V	possibly damaging	Het
Bud31	T	C	5: 145,142,569		probably null	Het
Ccdc42	A	G	11: 68,594,570	K105E	probably damaging	Het
Cenpq	A	G	17: 40,931,660	S93P	probably damaging	Het
Cfh	A	G	1: 140,086,421	F1222L	probably damaging	Het
Cpxm2	A	T	7: 132,106,281		probably null	Het
Cubn	T	C	2: 13,360,346	D1627G	possibly damaging	Het
Diras2	T	C	13: 52,507,701	E190G	possibly damaging	Het
Dpyd	G	C	3: 118,999,332	A563P	probably damaging	Het
Efcab8	T	A	2: 153,798,649	N343K		Het
Fam26d	A	G	10: 34,044,268	M1T	probably null	Het
Gbp2b	A	G	3: 142,608,279	E440G	probably benign	Het
Ghrhr	T	C	6: 55,378,906	F30L	probably benign	Het
Gm3404	T	A	5: 146,528,143	V231E	possibly damaging	Het
Gramd4	A	G	15: 86,100,892	H143R	probably damaging	Het
Greb1l	A	T	18: 10,544,896	E1408V	probably benign	Het
Hdgfl1	T	G	13: 26,770,024	Y22S	probably damaging	Het
Heatr1	T	A	13: 12,430,912	V1590D	probably damaging	Het
Hecw2	A	T	1: 53,904,449		probably benign	Het
Igkv8-30	C	A	6: 70,117,166	R87L	probably damaging	Het
Il18rap	T	A	1: 40,525,346	C179S	probably damaging	Het
Jph4	T	C	14: 55,114,077	T161A	possibly damaging	Het
Klhdc7a	A	T	4: 139,967,585	M17K	probably damaging	Het
Kpnb1	T	C	11: 97,165,383	N699S	probably benign	Het
Lama3	T	C	18: 12,449,586		probably null	Het
Lca5	A	G	9: 83,395,450	F614L	probably damaging	Het
Lyst	T	C	13: 13,637,562	V853A	probably benign	Het
Map2	A	T	1: 66,416,364	T1406S	probably damaging	Het
Med23	A	G	10: 24,895,719	I552V	possibly damaging	Het
Myo1h	A	T	5: 114,334,102	I414L		Het
Myom1	A	G	17: 71,106,204	K1271E	probably damaging	Het
Olfr126	A	T	17: 37,850,784	K64M	probably damaging	Het
Olfr133	T	A	17: 38,148,732	V48E	possibly damaging	Het
Olfr873	T	C	9: 20,300,773	F192S	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prdm2	A	T	4: 143,133,215	D1168E	possibly damaging	Het
Prr5	T	C	15: 84,699,715	M181T	probably damaging	Het
Ptpdc1	A	G	13: 48,590,692	I151T	probably damaging	Het
Ptpn7	T	C	1: 135,139,266	V287A	possibly damaging	Het
Ptprz1	T	C	6: 23,042,748	V2057A		Het
Rad17	G	T	13: 100,617,819	A631E	probably benign	Het
Sf3a2	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	10: 80,804,437		probably benign	Het
Slc22a2	A	T	17: 12,609,979	D324V	probably benign	Het
Ssfa2	A	G	2: 79,657,340	K589R	probably benign	Het
Taf4b	T	G	18: 14,830,070	D622E	probably benign	Het
Tgfbrap1	A	C	1: 43,075,813	N42K	probably benign	Het
Uvrag	A	G	7: 98,979,736	F375L	probably benign	Het
Vmn2r76	A	G	7: 86,228,791	I466T	probably damaging	Het
Vmn2r8	T	C	5: 108,808,751	K2E	probably damaging	Het
Vps13d	T	C	4: 145,155,202	T1274A		Het
Vwa3b	C	T	1: 37,035,758	A2V	possibly damaging	Het
Ylpm1	T	C	12: 85,069,620	V2092A	probably damaging	Het
Zfp638	T	C	6: 83,969,153	S1055P	probably damaging	Het
Zzef1	A	G	11: 72,863,989	T982A	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATTGACTCTACCACAGCC -3'
(R):5'- ACAGCTCAGGAATGAAGCC -3'

Sequencing Primer
(F):5'- CTCTGGTTTACTAGGCTACGAAG -3'
(R):5'- CCTGAACAGAAGGAGGCCCTG -3'

Posted On

2021-07-15