Incidental Mutation 'R8874:Strc'
ID676454
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R8874 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 121374872 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably null
Transcript: ENSMUST00000038389
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,825,671 M615V possibly damaging Het
Bud31 T C 5: 145,142,569 probably null Het
Ccdc42 A G 11: 68,594,570 K105E probably damaging Het
Cenpq A G 17: 40,931,660 S93P probably damaging Het
Cfh A G 1: 140,086,421 F1222L probably damaging Het
Cpxm2 A T 7: 132,106,281 probably null Het
Cubn T C 2: 13,360,346 D1627G possibly damaging Het
Diras2 T C 13: 52,507,701 E190G possibly damaging Het
Dpyd G C 3: 118,999,332 A563P probably damaging Het
Efcab8 T A 2: 153,798,649 N343K Het
Fam26d A G 10: 34,044,268 M1T probably null Het
Gbp2b A G 3: 142,608,279 E440G probably benign Het
Ghrhr T C 6: 55,378,906 F30L probably benign Het
Gm3404 T A 5: 146,528,143 V231E possibly damaging Het
Gramd4 A G 15: 86,100,892 H143R probably damaging Het
Greb1l A T 18: 10,544,896 E1408V probably benign Het
Hdgfl1 T G 13: 26,770,024 Y22S probably damaging Het
Heatr1 T A 13: 12,430,912 V1590D probably damaging Het
Igkv8-30 C A 6: 70,117,166 R87L probably damaging Het
Il18rap T A 1: 40,525,346 C179S probably damaging Het
Jph4 T C 14: 55,114,077 T161A possibly damaging Het
Klhdc7a A T 4: 139,967,585 M17K probably damaging Het
Kpnb1 T C 11: 97,165,383 N699S probably benign Het
Lama3 T C 18: 12,449,586 probably null Het
Lca5 A G 9: 83,395,450 F614L probably damaging Het
Lyst T C 13: 13,637,562 V853A probably benign Het
Map2 A T 1: 66,416,364 T1406S probably damaging Het
Med23 A G 10: 24,895,719 I552V possibly damaging Het
Myo1h A T 5: 114,334,102 I414L Het
Myom1 A G 17: 71,106,204 K1271E probably damaging Het
Olfr126 A T 17: 37,850,784 K64M probably damaging Het
Olfr133 T A 17: 38,148,732 V48E possibly damaging Het
Olfr873 T C 9: 20,300,773 F192S possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prdm2 A T 4: 143,133,215 D1168E possibly damaging Het
Prr5 T C 15: 84,699,715 M181T probably damaging Het
Ptpdc1 A G 13: 48,590,692 I151T probably damaging Het
Ptpn7 T C 1: 135,139,266 V287A possibly damaging Het
Ptprz1 T C 6: 23,042,748 V2057A Het
Rad17 G T 13: 100,617,819 A631E probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Slc22a2 A T 17: 12,609,979 D324V probably benign Het
Ssfa2 A G 2: 79,657,340 K589R probably benign Het
Taf4b T G 18: 14,830,070 D622E probably benign Het
Tgfbrap1 A C 1: 43,075,813 N42K probably benign Het
Tnfrsf25 ACTGCTGCTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTGCTGCT 4: 152,116,599 probably benign Het
Uvrag A G 7: 98,979,736 F375L probably benign Het
Vmn2r76 A G 7: 86,228,791 I466T probably damaging Het
Vmn2r8 T C 5: 108,808,751 K2E probably damaging Het
Vps13d T C 4: 145,155,202 T1274A Het
Vwa3b C T 1: 37,035,758 A2V possibly damaging Het
Ylpm1 T C 12: 85,069,620 V2092A probably damaging Het
Zfp638 T C 6: 83,969,153 S1055P probably damaging Het
Zzef1 A G 11: 72,863,989 T982A probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
R8792:Strc UTSW 2 121377805 missense probably damaging 0.99
R8947:Strc UTSW 2 121370989 missense probably benign 0.09
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATTGACTCTACCACAGCC -3'
(R):5'- ACAGCTCAGGAATGAAGCC -3'

Sequencing Primer
(F):5'- CTCTGGTTTACTAGGCTACGAAG -3'
(R):5'- CCTGAACAGAAGGAGGCCCTG -3'
Posted On2021-07-15