Mutagenetix > Incidental Mutations

Incidental Mutation 'R7822:Strc'

601909

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R7822 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121377738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 384 (T384N)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: T384N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: T384N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap21	G	A	2: 20,880,713	S551L	possibly damaging	Het
Arhgap8	A	C	15: 84,765,732	Y219S	probably damaging	Het
Ash1l	T	C	3: 89,007,264	S1734P	probably benign	Het
Btnl2	T	A	17: 34,363,314	S285T	possibly damaging	Het
Cadm4	A	G	7: 24,503,545	D364G	possibly damaging	Het
Card6	T	A	15: 5,098,865	K1016N	possibly damaging	Het
Ccdc130	T	C	8: 84,261,782	E72G	probably damaging	Het
Cdh2	G	T	18: 16,624,284	N692K	probably benign	Het
Cep76	G	T	18: 67,641,149	S9*	probably null	Het
Cklf	T	C	8: 104,251,097		probably null	Het
Ctsa	T	C	2: 164,839,232	*475R	probably null	Het
Dapk1	A	C	13: 60,725,901	D406A	probably benign	Het
Ddx4	A	T	13: 112,612,113	V443D	probably damaging	Het
Dph5	C	T	3: 115,899,750	Q106*	probably null	Het
Drg2	C	T	11: 60,462,200	R220*	probably null	Het
Efcab8	A	T	2: 153,810,912	Q509L	unknown	Het
Efs	C	T	14: 54,917,450	S444N	probably benign	Het
Evl	T	C	12: 108,648,464	V58A	probably damaging	Het
Fam71b	A	G	11: 46,404,903	N34S		Het
Gbe1	G	A	16: 70,433,612	R166H	probably damaging	Het
Gcc1	T	C	6: 28,418,786	E516G	probably damaging	Het
Ghr	T	C	15: 3,457,957	T15A	probably benign	Het
Gnb4	G	A	3: 32,596,331	T50M	probably damaging	Het
Grik3	T	C	4: 125,656,397		probably null	Het
Gstk1	T	C	6: 42,247,752	Y135H	probably benign	Het
Gucy2c	T	A	6: 136,708,406	I846F	probably damaging	Het
Itga7	A	G	10: 128,942,966	T321A	probably benign	Het
Jakmip1	A	T	5: 37,175,180	N1068I	probably damaging	Het
Krt36	A	G	11: 100,104,140	I202T	possibly damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Mast2	A	G	4: 116,312,873	L741P	probably damaging	Het
Mctp2	T	C	7: 72,127,187	N720S	possibly damaging	Het
Mmp9	A	T	2: 164,949,036	K115*	probably null	Het
Mtf2	C	T	5: 108,080,877	R20*	probably null	Het
Mycbp2	T	G	14: 103,139,415	Q3810P	probably benign	Het
Myom2	A	T	8: 15,108,454	H802L	probably benign	Het
Naa25	A	G	5: 121,407,213	N27D	probably damaging	Het
Necab2	T	C	8: 119,454,364	F126L	probably damaging	Het
Nisch	C	G	14: 31,174,651		probably benign	Het
Nsd2	T	A	5: 33,843,594	S152T	probably damaging	Het
Ntsr1	T	C	2: 180,538,690	L263P	probably damaging	Het
Nup210	A	G	6: 91,018,777	V922A	possibly damaging	Het
Olfr109	T	A	17: 37,467,103	M299K	probably benign	Het
Olfr1175-ps	A	C	2: 88,323,081	I208S	probably benign	Het
Olfr1458	T	A	19: 13,103,053	I84F	probably benign	Het
Pccb	C	A	9: 101,027,084	C144F	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Prdm1	A	G	10: 44,458,482	V16A	probably benign	Het
Psme4	A	G	11: 30,874,245	D1743G	probably benign	Het
Rad21l	G	T	2: 151,655,125	D356E	probably benign	Het
Rars	A	G	11: 35,819,966	I322T	probably damaging	Het
Retreg2	C	A	1: 75,146,541	P319Q	possibly damaging	Het
Robo2	T	C	16: 73,973,171	Y559C	probably damaging	Het
Ror1	T	C	4: 100,441,367	Y646H	probably damaging	Het
Rrp15	A	G	1: 186,749,176	S45P	probably benign	Het
Sacs	G	C	14: 61,192,203	K570N	probably benign	Het
Serpinb8	C	T	1: 107,606,993	Q265*	probably null	Het
Sgo2b	T	C	8: 63,927,284	E838G	probably damaging	Het
Slc2a12	G	A	10: 22,664,669	R141K	probably damaging	Het
Tcaf2	T	C	6: 42,629,099	S547G	possibly damaging	Het
Tekt5	T	C	16: 10,382,928	N243S	possibly damaging	Het
Tgm3	A	G	2: 130,041,899	I492M	probably benign	Het
Tgm7	G	A	2: 121,103,940	T157I	probably benign	Het
Trnp1	C	A	4: 133,498,039	R140L	possibly damaging	Het
Ttn	A	G	2: 76,779,433	V15797A	probably damaging	Het
Ugp2	A	T	11: 21,333,762	S102T	probably benign	Het
Vav2	A	T	2: 27,282,287		probably null	Het
Vmn1r202	T	A	13: 22,502,071	I59F	probably damaging	Het
Zfp109	T	C	7: 24,229,145	T288A	probably benign	Het
Zscan12	T	A	13: 21,369,204	H399Q	probably damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTGCGTACCATACAGCTG -3'
(R):5'- TGGGTTTTCTATCTGGATCACCAC -3'

Sequencing Primer
(F):5'- TACCATACAGCTGTCTGGCAG -3'
(R):5'- TGCCTGAGCAGAGGTGTGC -3'

Posted On

2019-12-03