Incidental Mutation 'R8874:Med23'
ID676477
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8874 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24895719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 552 (I552V)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: I546V

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: I546V

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092646
AA Change: I552V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: I552V

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176285
AA Change: I186V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: I186V

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,825,671 M615V possibly damaging Het
Bud31 T C 5: 145,142,569 probably null Het
Ccdc42 A G 11: 68,594,570 K105E probably damaging Het
Cenpq A G 17: 40,931,660 S93P probably damaging Het
Cfh A G 1: 140,086,421 F1222L probably damaging Het
Cpxm2 A T 7: 132,106,281 probably null Het
Cubn T C 2: 13,360,346 D1627G possibly damaging Het
Diras2 T C 13: 52,507,701 E190G possibly damaging Het
Dpyd G C 3: 118,999,332 A563P probably damaging Het
Efcab8 T A 2: 153,798,649 N343K Het
Fam26d A G 10: 34,044,268 M1T probably null Het
Gbp2b A G 3: 142,608,279 E440G probably benign Het
Ghrhr T C 6: 55,378,906 F30L probably benign Het
Gm3404 T A 5: 146,528,143 V231E possibly damaging Het
Gramd4 A G 15: 86,100,892 H143R probably damaging Het
Greb1l A T 18: 10,544,896 E1408V probably benign Het
Hdgfl1 T G 13: 26,770,024 Y22S probably damaging Het
Heatr1 T A 13: 12,430,912 V1590D probably damaging Het
Igkv8-30 C A 6: 70,117,166 R87L probably damaging Het
Il18rap T A 1: 40,525,346 C179S probably damaging Het
Jph4 T C 14: 55,114,077 T161A possibly damaging Het
Klhdc7a A T 4: 139,967,585 M17K probably damaging Het
Kpnb1 T C 11: 97,165,383 N699S probably benign Het
Lama3 T C 18: 12,449,586 probably null Het
Lca5 A G 9: 83,395,450 F614L probably damaging Het
Lyst T C 13: 13,637,562 V853A probably benign Het
Map2 A T 1: 66,416,364 T1406S probably damaging Het
Myo1h A T 5: 114,334,102 I414L Het
Myom1 A G 17: 71,106,204 K1271E probably damaging Het
Olfr126 A T 17: 37,850,784 K64M probably damaging Het
Olfr133 T A 17: 38,148,732 V48E possibly damaging Het
Olfr873 T C 9: 20,300,773 F192S possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prdm2 A T 4: 143,133,215 D1168E possibly damaging Het
Prr5 T C 15: 84,699,715 M181T probably damaging Het
Ptpdc1 A G 13: 48,590,692 I151T probably damaging Het
Ptpn7 T C 1: 135,139,266 V287A possibly damaging Het
Ptprz1 T C 6: 23,042,748 V2057A Het
Rad17 G T 13: 100,617,819 A631E probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Slc22a2 A T 17: 12,609,979 D324V probably benign Het
Ssfa2 A G 2: 79,657,340 K589R probably benign Het
Strc C T 2: 121,374,872 probably null Het
Taf4b T G 18: 14,830,070 D622E probably benign Het
Tgfbrap1 A C 1: 43,075,813 N42K probably benign Het
Tnfrsf25 ACTGCTGCTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTGCTGCT 4: 152,116,599 probably benign Het
Uvrag A G 7: 98,979,736 F375L probably benign Het
Vmn2r76 A G 7: 86,228,791 I466T probably damaging Het
Vmn2r8 T C 5: 108,808,751 K2E probably damaging Het
Vps13d T C 4: 145,155,202 T1274A Het
Vwa3b C T 1: 37,035,758 A2V possibly damaging Het
Ylpm1 T C 12: 85,069,620 V2092A probably damaging Het
Zfp638 T C 6: 83,969,153 S1055P probably damaging Het
Zzef1 A G 11: 72,863,989 T982A probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACCGCAGTTTGTTTCCAG -3'
(R):5'- TCACGTCAGACACTTGCTCC -3'

Sequencing Primer
(F):5'- AGTTGTCCAGATGCCACTAC -3'
(R):5'- AGACACTTGCTCCCTGCTTC -3'
Posted On2021-07-15