Mutagenetix > Incidental Mutation

Incidental Mutation 'R1650:Strc'

174161

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

039686-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R1650 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to C at 121380885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149219

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.0%
20x: 83.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	G	2: 103,702,402	V515G	probably damaging	Het
Arl5a	A	T	2: 52,412,105	I99N	probably damaging	Het
Atp8b1	A	G	18: 64,571,549		probably benign	Het
Bag4	T	A	8: 25,777,424	Q126L	probably damaging	Het
Ccser1	A	G	6: 61,638,490	T659A	probably benign	Het
Cenpn	A	G	8: 116,934,759	D199G	probably damaging	Het
Cfhr3	A	G	1: 139,593,826		noncoding transcript	Het
Clca2	T	A	3: 145,092,212	H164L	probably damaging	Het
Col5a1	C	A	2: 27,922,159	S84R	unknown	Het
Ctsc	T	A	7: 88,281,426	L71*	probably null	Het
Cyp2c70	A	G	19: 40,165,477	Y223H	probably benign	Het
Dbt	A	G	3: 116,534,732		probably null	Het
Dlg2	T	C	7: 92,431,051	V614A	probably damaging	Het
Dll4	T	C	2: 119,331,130	S398P	probably damaging	Het
Dyrk4	T	C	6: 126,899,829	K62E	probably benign	Het
Fam35a	T	A	14: 34,259,617		probably benign	Het
Fgf22	A	T	10: 79,755,189	Y24F	probably damaging	Het
Ggt5	A	G	10: 75,604,761	R239G	probably benign	Het
Gm11360	C	T	13: 27,956,396	A81V	unknown	Het
Htr5b	T	A	1: 121,528,162	T10S	probably benign	Het
Igsf10	T	C	3: 59,326,162	R1717G	probably damaging	Het
Itsn2	T	A	12: 4,637,767	V556D	probably damaging	Het
Kdm3b	T	C	18: 34,809,115	V553A	possibly damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lca5l	T	C	16: 96,178,940		probably null	Het
Lmbrd1	T	C	1: 24,711,558	W171R	probably damaging	Het
Lrp6	T	C	6: 134,468,769	Y1027C	probably benign	Het
Macf1	A	T	4: 123,456,600	Y1702*	probably null	Het
Mon2	T	C	10: 122,995,777	I1675V	probably benign	Het
Mtcl1	T	A	17: 66,385,876	K486M	probably damaging	Het
Nek1	A	T	8: 61,036,076	H338L	probably benign	Het
Ola1	A	T	2: 73,156,894	D131E	possibly damaging	Het
Olfr1128	C	A	2: 87,545,428	V39L	probably benign	Het
Olfr1158	C	T	2: 87,990,801	A230V	probably benign	Het
Olfr1280	C	T	2: 111,316,295	A272V	probably benign	Het
Olfr1366	T	C	13: 21,537,079	N294D	probably damaging	Het
Olfr141	A	T	2: 86,806,747	M84K	possibly damaging	Het
Olfr845	T	G	9: 19,338,647	F62L	possibly damaging	Het
Olr1	T	A	6: 129,507,089	M7L	probably benign	Het
Pan2	G	A	10: 128,317,899	E980K	probably damaging	Het
Pgm2	A	G	4: 99,962,070	K146E	possibly damaging	Het
Pgm2	C	A	4: 99,962,079	Q149K	probably benign	Het
Phlpp2	T	C	8: 109,933,955		probably benign	Het
Plekhs1	G	T	19: 56,471,042	G75C	probably damaging	Het
Plin4	G	A	17: 56,104,931	T700I	probably damaging	Het
Podxl2	G	A	6: 88,849,919	P71L	probably benign	Het
Pot1a	A	T	6: 25,745,965	V579D	probably damaging	Het
Poteg	A	G	8: 27,463,785	D318G	probably benign	Het
Ppp4r3a	A	T	12: 101,044,619	D554E	probably damaging	Het
Proser3	G	A	7: 30,540,326	A451V	probably damaging	Het
Rnf165	A	C	18: 77,462,417		probably null	Het
Syce1	C	A	7: 140,778,387	C216F	possibly damaging	Het
Syne2	A	T	12: 75,904,259	K395*	probably null	Het
Trim28	G	A	7: 13,030,849	G831D	possibly damaging	Het
Tyw1	A	G	5: 130,288,911	I434V	possibly damaging	Het
Ubox5	G	A	2: 130,600,425	A114V	probably benign	Het
Ubqln3	C	T	7: 104,141,021	V621I	possibly damaging	Het
Unc79	A	G	12: 103,112,793	D1543G	possibly damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Wrnip1	C	A	13: 32,805,379	H283Q	probably benign	Het
Zan	A	T	5: 137,394,601		probably benign	Het
Zcchc10	A	T	11: 53,327,402	K1*	probably null	Het
Zfp592	T	A	7: 81,038,100	S925T	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAAACACCGTTTTAAAGAGGGGAA -3'
(R):5'- ACTGCTGGCTGCCAGACCATTT -3'

Sequencing Primer
(F):5'- GGAAAGGTTATTTGCCTTCATCC -3'
(R):5'- GTCATTGGTCCCTCTAACAGAAG -3'

Posted On

2014-04-24