Incidental Mutation 'R8943:Scn7a'
ID 706148
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms NaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R8943 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66673425-66784914 bp(-) (GRCm38)
Type of Mutation synonymous
DNA Base Change (assembly) A to T at 66694862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect silent
Transcript: ENSMUST00000042792
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,243 S457P probably damaging Het
Aak1 A G 6: 86,987,252 N945S unknown Het
Actr1a C A 19: 46,380,999 R192L possibly damaging Het
Adgrl2 T A 3: 148,828,483 N1036I probably damaging Het
Ak5 A G 3: 152,655,874 V137A probably damaging Het
Aldh1a2 T C 9: 71,261,773 V179A probably damaging Het
Ap2b1 A T 11: 83,346,753 I548F probably damaging Het
Arhgef10l A G 4: 140,565,239 Y352H probably damaging Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Atoh7 A G 10: 63,100,159 K2E possibly damaging Het
BC061237 A G 14: 44,504,201 I134V probably benign Het
Cadm1 T C 9: 47,789,838 I141T probably damaging Het
Capn10 T C 1: 92,943,732 S351P probably damaging Het
Cct6b T C 11: 82,764,133 probably benign Het
Cd19 T C 7: 126,412,158 T284A probably benign Het
Cfap53 A G 18: 74,299,182 Y47C probably damaging Het
Cldn18 T C 9: 99,696,109 M194V probably benign Het
Dgkb T A 12: 38,602,778 Y721N probably damaging Het
Dmbt1 A G 7: 131,119,643 Q1880R possibly damaging Het
Dock2 T C 11: 34,708,819 N311S possibly damaging Het
Dpysl5 G T 5: 30,778,031 M159I probably benign Het
Eif2b3 G A 4: 117,044,581 G147E probably damaging Het
Fam193a A G 5: 34,440,452 D531G probably benign Het
Fndc3b T C 3: 27,501,180 probably benign Het
Foxe3 C A 4: 114,925,326 A230S unknown Het
Gm14548 T C 7: 3,895,366 E319G probably benign Het
Gm5591 A T 7: 38,520,303 V382E probably benign Het
Gm7995 A T 14: 42,310,271 N21I probably damaging Het
Ipo8 G A 6: 148,775,049 P981S probably benign Het
Kcnh8 A G 17: 52,797,458 D161G probably benign Het
Krt71 A G 15: 101,736,745 I377T possibly damaging Het
Krt75 A T 15: 101,568,332 M374K probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lpcat1 A G 13: 73,513,910 T409A probably benign Het
Lrch1 A T 14: 74,795,368 I514K probably benign Het
Mc4r A C 18: 66,860,039 M1R probably null Het
Mthfd1l A T 10: 4,028,466 H442L probably damaging Het
Olfr1166 T A 2: 88,124,374 I204F probably damaging Het
Pdcd1lg2 T C 19: 29,446,153 M199T probably benign Het
Pigg G A 5: 108,336,200 V438M probably damaging Het
Ppfibp1 T A 6: 147,019,183 probably null Het
Rbm15 T A 3: 107,332,056 Y342F possibly damaging Het
Rhbdl1 A T 17: 25,835,142 V278E probably damaging Het
Ryr3 T C 2: 112,635,324 N4781S probably damaging Het
Sfswap A G 5: 129,504,104 R114G probably damaging Het
Sohlh2 C A 3: 55,196,861 A258D possibly damaging Het
Sstr4 T A 2: 148,395,862 V131D possibly damaging Het
Tenm2 T C 11: 36,944,034 T45A probably damaging Het
Tmem131l A T 3: 83,924,172 F818I probably damaging Het
Trappc6b A G 12: 59,050,363 F58L probably damaging Het
Vmn1r229 A T 17: 20,815,156 H221L possibly damaging Het
Vmn1r33 T A 6: 66,611,799 Y257F probably damaging Het
Wdfy3 T C 5: 101,845,365 probably benign Het
Zfp446 C T 7: 12,979,637 Q177* probably null Het
Zufsp A G 10: 33,919,305 *552Q probably null Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
alert UTSW 2 66680246 nonsense probably null
glimmer UTSW 2 66743703 missense probably damaging 0.96
Uptick UTSW 2 66700049 nonsense probably null
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 splice site probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7914:Scn7a UTSW 2 66699950 missense probably damaging 0.97
R7953:Scn7a UTSW 2 66757326 missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66675829 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
R8121:Scn7a UTSW 2 66700859 missense probably damaging 1.00
R8172:Scn7a UTSW 2 66675847 missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66675974 missense probably damaging 1.00
R8431:Scn7a UTSW 2 66703820 missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66743697 splice site probably benign
R8745:Scn7a UTSW 2 66680182 missense probably benign
R8781:Scn7a UTSW 2 66737431 missense probably benign 0.03
R8848:Scn7a UTSW 2 66700049 nonsense probably null
R8878:Scn7a UTSW 2 66675855 missense probably damaging 1.00
R8991:Scn7a UTSW 2 66684244 missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66680112 missense probably damaging 1.00
R9501:Scn7a UTSW 2 66752235 missense probably benign 0.00
R9546:Scn7a UTSW 2 66752259 missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66689558 missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACAGCTTTTACCTACCAC -3'
(R):5'- TTTCAGGTCAGCCACAACTAC -3'

Sequencing Primer
(F):5'- GAGACAGCTTTTACCTACCACATTAC -3'
(R):5'- GGTCAGCCACAACTACTTTAAAATC -3'
Posted On 2022-04-01