Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Gabrb1'

715625

Institutional Source

Beutler Lab

Gene Symbol

Gabrb1

Ensembl Gene

ENSMUSG00000029212

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 1

Synonyms

Gabrb-1, B230208N19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71658113-72149037 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 72108347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 195 (G195E)

Ref Sequence

ENSEMBL: ENSMUSP00000031122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]

AlphaFold

P50571

Predicted Effect

probably damaging
Transcript: ENSMUST00000031122
AA Change: G195E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: G195E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	37	243	7.1e-52	PFAM
Pfam:Neur_chan_memb	250	469	2.4e-48	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: G162E

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	4	210	4.8e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Gabrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL00774:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL01534:Gabrb1	APN	5	71869429	missense	possibly damaging	0.95
IGL02170:Gabrb1	APN	5	72136730	missense	probably damaging	1.00
IGL02326:Gabrb1	APN	5	71700847	missense	probably damaging	0.99
IGL03278:Gabrb1	APN	5	71869596	missense	probably damaging	1.00
IGL03345:Gabrb1	APN	5	72136565	missense	possibly damaging	0.53
IGL03050:Gabrb1	UTSW	5	72122154	missense	probably benign	0.03
PIT4445001:Gabrb1	UTSW	5	72108782	missense	probably damaging	1.00
PIT4515001:Gabrb1	UTSW	5	71700817	missense	probably damaging	1.00
R0109:Gabrb1	UTSW	5	72121946	splice site	probably benign
R0386:Gabrb1	UTSW	5	72108807	missense	probably damaging	0.99
R1512:Gabrb1	UTSW	5	72108704	missense	probably damaging	1.00
R1512:Gabrb1	UTSW	5	72108705	missense	probably damaging	1.00
R1717:Gabrb1	UTSW	5	72108351	splice site	probably null
R1832:Gabrb1	UTSW	5	72121938	splice site	probably null
R1961:Gabrb1	UTSW	5	71700336	missense	probably benign	0.28
R2363:Gabrb1	UTSW	5	71869573	nonsense	probably null
R4686:Gabrb1	UTSW	5	71700022	missense	possibly damaging	0.53
R4840:Gabrb1	UTSW	5	71700811	missense	probably damaging	1.00
R4916:Gabrb1	UTSW	5	71869421	missense	probably damaging	1.00
R4941:Gabrb1	UTSW	5	72136778	missense	probably damaging	1.00
R5250:Gabrb1	UTSW	5	71869579	missense	possibly damaging	0.80
R5270:Gabrb1	UTSW	5	72108326	missense	probably damaging	1.00
R5364:Gabrb1	UTSW	5	72136762	missense	probably benign	0.33
R5407:Gabrb1	UTSW	5	72122021	missense	possibly damaging	0.90
R5621:Gabrb1	UTSW	5	72108728	missense	probably damaging	1.00
R5790:Gabrb1	UTSW	5	72136484	missense	possibly damaging	0.53
R6236:Gabrb1	UTSW	5	72108320	missense	probably damaging	1.00
R6336:Gabrb1	UTSW	5	72029898	missense	possibly damaging	0.72
R7411:Gabrb1	UTSW	5	72122195	critical splice donor site	probably null
R8375:Gabrb1	UTSW	5	72029829	missense	probably damaging	0.98
R9161:Gabrb1	UTSW	5	72029856	missense	probably damaging	0.98
R9621:Gabrb1	UTSW	5	72122020	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GGCACTCCATATAAGCTCTATCTGC -3'
(R):5'- TAGTCGTGGATATGCCCCTG -3'

Sequencing Primer
(F):5'- ATAAGCTCTATCTGCCATTCAAGTTC -3'
(R):5'- TGCCCCTGGGTTATAGAAAAC -3'

Posted On

2022-06-15