Incidental Mutation 'R9474:Hmcn1'
ID 715604
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms LOC240793, EG545370
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 150562524-150993435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 150630720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 3779 (R3779W)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: R3779W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: R3779W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: R3779W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: R3779W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 (GRCm38) K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 (GRCm38) M303T probably damaging Het
Adam5 A T 8: 24,747,524 (GRCm38) D623E possibly damaging Het
Akt3 T C 1: 177,025,386 (GRCm38) Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 (GRCm38) Y217H probably damaging Het
Clca4b T A 3: 144,911,166 (GRCm38) T908S probably benign Het
Clec7a G A 6: 129,463,163 (GRCm38) Q160* probably null Het
Cntnap4 T A 8: 112,733,471 (GRCm38) I152N probably damaging Het
Ctdspl C T 9: 119,037,377 (GRCm38) A179V probably damaging Het
Ddx43 T C 9: 78,406,386 (GRCm38) S200P probably damaging Het
Dip2c A G 13: 9,494,927 (GRCm38) D84G unknown Het
Dmbt1 G A 7: 131,074,257 (GRCm38) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 (GRCm38) probably benign Het
E2f7 C T 10: 110,767,189 (GRCm38) T355I probably damaging Het
E2f7 C A 10: 110,779,057 (GRCm38) L541M probably damaging Het
Elovl5 T A 9: 77,982,725 (GRCm38) S273T possibly damaging Het
Emc1 T A 4: 139,366,394 (GRCm38) L605Q probably damaging Het
Fras1 T A 5: 96,739,265 (GRCm38) D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 (GRCm38) G195E probably damaging Het
Galm A G 17: 80,150,132 (GRCm38) D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 (GRCm38) S20R probably damaging Het
Gm21671 A T 5: 25,953,138 (GRCm38) I72N probably damaging Het
Grb14 T G 2: 64,938,400 (GRCm38) Y189S probably damaging Het
Hk2 T A 6: 82,728,914 (GRCm38) I803F probably damaging Het
Hmgcr A C 13: 96,659,895 (GRCm38) M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 (GRCm38) K68N possibly damaging Het
Inhba A C 13: 16,017,678 (GRCm38) E128A probably benign Het
Itpr3 G A 17: 27,118,677 (GRCm38) probably benign Het
Klhl3 G A 13: 58,019,459 (GRCm38) P364S probably damaging Het
Lhpp T C 7: 132,641,583 (GRCm38) L176P probably damaging Het
Lrp1b C A 2: 40,601,587 (GRCm38) A223S probably damaging Het
Lrp3 A G 7: 35,204,064 (GRCm38) F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 (GRCm38) T1337A probably benign Het
Magi2 A G 5: 20,195,021 (GRCm38) D17G probably benign Het
Map3k21 T C 8: 125,924,164 (GRCm38) S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 (GRCm38) D386G probably benign Het
Mfsd2b A T 12: 4,866,820 (GRCm38) D306E possibly damaging Het
Muc20 T C 16: 32,794,083 (GRCm38) E308G probably damaging Het
Myh13 G A 11: 67,364,886 (GRCm38) S34N Het
Nebl C A 2: 17,369,610 (GRCm38) G894* probably null Het
Nelfa A G 5: 33,898,751 (GRCm38) Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 (GRCm38) D13G probably benign Het
Ninl A T 2: 150,940,806 (GRCm38) S170T probably benign Het
Nlrp4c G A 7: 6,065,627 (GRCm38) V176M possibly damaging Het
Nobox G A 6: 43,307,181 (GRCm38) R144C probably damaging Het
Oas1a G A 5: 120,899,254 (GRCm38) L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 (GRCm38) M15T probably benign Het
Olfr1153 T C 2: 87,896,349 (GRCm38) M50T probably benign Het
Olfr1254 A C 2: 89,789,162 (GRCm38) Y63* probably null Het
Olfr1348 A G 7: 6,502,151 (GRCm38) L25P probably benign Het
Olfr1356 T C 10: 78,847,057 (GRCm38) N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 (GRCm38) Y184F probably damaging Het
Orai1 A G 5: 123,029,238 (GRCm38) N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 (GRCm38) V121L probably benign Het
Pclo T C 5: 14,521,236 (GRCm38) S212P possibly damaging Het
Plce1 G A 19: 38,777,893 (GRCm38) E2121K possibly damaging Het
Plg A G 17: 12,403,137 (GRCm38) Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 (GRCm38) N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 (GRCm38) L373S probably benign Het
Rnpep A G 1: 135,283,603 (GRCm38) F136L probably benign Het
Rp1 A G 1: 4,092,615 (GRCm38) probably null Het
Shank1 G A 7: 44,312,918 (GRCm38) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 (GRCm38) probably benign Het
Slc5a5 T C 8: 70,884,952 (GRCm38) D574G probably benign Het
Slc7a15 T A 12: 8,538,794 (GRCm38) N251I probably damaging Het
Susd4 T C 1: 182,892,100 (GRCm38) S427P probably benign Het
Tarbp1 T A 8: 126,429,040 (GRCm38) T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 (GRCm38) V166I probably benign Het
Thbs1 T C 2: 118,120,037 (GRCm38) probably null Het
Tnfsf13b A G 8: 10,031,648 (GRCm38) Y270C probably damaging Het
Vps11 G T 9: 44,348,993 (GRCm38) C857* probably null Het
Vsig10 G A 5: 117,325,039 (GRCm38) R110H probably benign Het
Wee2 T A 6: 40,455,110 (GRCm38) Y204* probably null Het
Zfpm2 T A 15: 41,103,471 (GRCm38) S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 (GRCm38) N166S probably benign Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,677,278 (GRCm38) missense probably benign
IGL00571:Hmcn1 APN 1 150,638,999 (GRCm38) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,806,366 (GRCm38) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,664,936 (GRCm38) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,656,734 (GRCm38) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,630,340 (GRCm38) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,610,713 (GRCm38) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,605,006 (GRCm38) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,582,301 (GRCm38) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,638,869 (GRCm38) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,627,033 (GRCm38) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,632,552 (GRCm38) splice site probably benign
IGL01304:Hmcn1 APN 1 150,622,924 (GRCm38) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,745,001 (GRCm38) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,719,240 (GRCm38) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,593,097 (GRCm38) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,859,239 (GRCm38) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,605,072 (GRCm38) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,609,631 (GRCm38) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,598,397 (GRCm38) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,627,413 (GRCm38) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,672,032 (GRCm38) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,580,233 (GRCm38) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,737,299 (GRCm38) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,583,280 (GRCm38) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,744,960 (GRCm38) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,672,038 (GRCm38) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,615,300 (GRCm38) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,690,601 (GRCm38) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,742,260 (GRCm38) splice site probably benign
IGL01906:Hmcn1 APN 1 150,667,887 (GRCm38) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,732,892 (GRCm38) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,603,871 (GRCm38) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,615,298 (GRCm38) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,704,181 (GRCm38) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,630,728 (GRCm38) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,722,607 (GRCm38) missense probably benign
IGL02155:Hmcn1 APN 1 150,563,598 (GRCm38) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,806,401 (GRCm38) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,664,915 (GRCm38) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,802,897 (GRCm38) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,722,424 (GRCm38) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,993,023 (GRCm38) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,809,726 (GRCm38) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,697,493 (GRCm38) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,744,995 (GRCm38) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,619,009 (GRCm38) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,604,903 (GRCm38) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,656,694 (GRCm38) nonsense probably null
IGL02735:Hmcn1 APN 1 150,646,832 (GRCm38) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,563,828 (GRCm38) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,675,974 (GRCm38) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,577,278 (GRCm38) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,657,207 (GRCm38) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,697,522 (GRCm38) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,671,917 (GRCm38) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,808,539 (GRCm38) missense probably benign
IGL03195:Hmcn1 APN 1 150,802,909 (GRCm38) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,743,667 (GRCm38) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,770,352 (GRCm38) splice site probably benign
IGL03268:Hmcn1 APN 1 150,772,510 (GRCm38) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,598,424 (GRCm38) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,630,231 (GRCm38) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,732,910 (GRCm38) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,701,969 (GRCm38) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,663,872 (GRCm38) missense probably damaging 1.00
Backbone UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
Cambrian UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
chordate UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
Justamere UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
Lancelet UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
notochord UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
wippoorwill UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,738,658 (GRCm38) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,720,689 (GRCm38) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,808,737 (GRCm38) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,669,487 (GRCm38) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,808,676 (GRCm38) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,652,551 (GRCm38) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,677,406 (GRCm38) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,808,647 (GRCm38) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,677,324 (GRCm38) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,663,879 (GRCm38) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,603,811 (GRCm38) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,798,814 (GRCm38) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,715,822 (GRCm38) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,732,792 (GRCm38) splice site probably benign
R0503:Hmcn1 UTSW 1 150,859,252 (GRCm38) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,876,419 (GRCm38) splice site probably benign
R0506:Hmcn1 UTSW 1 150,742,341 (GRCm38) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,719,117 (GRCm38) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,650,017 (GRCm38) nonsense probably null
R0599:Hmcn1 UTSW 1 150,609,801 (GRCm38) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,657,376 (GRCm38) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,594,016 (GRCm38) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,798,719 (GRCm38) splice site probably null
R0699:Hmcn1 UTSW 1 150,819,410 (GRCm38) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,808,787 (GRCm38) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,753,665 (GRCm38) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,650,073 (GRCm38) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R0975:Hmcn1 UTSW 1 150,577,377 (GRCm38) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1233:Hmcn1 UTSW 1 150,749,026 (GRCm38) missense probably benign
R1234:Hmcn1 UTSW 1 150,753,654 (GRCm38) nonsense probably null
R1291:Hmcn1 UTSW 1 150,748,191 (GRCm38) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,680,715 (GRCm38) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,646,794 (GRCm38) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,652,506 (GRCm38) splice site probably benign
R1458:Hmcn1 UTSW 1 150,609,700 (GRCm38) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,772,552 (GRCm38) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,669,421 (GRCm38) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,773,803 (GRCm38) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,734,532 (GRCm38) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,657,241 (GRCm38) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,745,027 (GRCm38) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,669,558 (GRCm38) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,630,333 (GRCm38) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,565,369 (GRCm38) nonsense probably null
R1710:Hmcn1 UTSW 1 150,675,984 (GRCm38) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,859,186 (GRCm38) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,599,030 (GRCm38) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,563,568 (GRCm38) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,749,083 (GRCm38) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,627,152 (GRCm38) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,598,285 (GRCm38) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,721,664 (GRCm38) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,657,193 (GRCm38) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,603,812 (GRCm38) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,720,695 (GRCm38) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,577,295 (GRCm38) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,657,451 (GRCm38) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,992,855 (GRCm38) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,604,882 (GRCm38) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,649,676 (GRCm38) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,677,376 (GRCm38) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,675,991 (GRCm38) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,738,613 (GRCm38) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,677,334 (GRCm38) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,577,323 (GRCm38) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,633,659 (GRCm38) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,715,815 (GRCm38) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,599,010 (GRCm38) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,624,598 (GRCm38) splice site probably benign
R2303:Hmcn1 UTSW 1 150,704,226 (GRCm38) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,652,678 (GRCm38) splice site probably benign
R2338:Hmcn1 UTSW 1 150,622,934 (GRCm38) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,565,384 (GRCm38) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,860,341 (GRCm38) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,599,032 (GRCm38) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,615,221 (GRCm38) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,686,867 (GRCm38) nonsense probably null
R2519:Hmcn1 UTSW 1 150,773,820 (GRCm38) nonsense probably null
R2520:Hmcn1 UTSW 1 150,743,647 (GRCm38) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,652,575 (GRCm38) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,630,652 (GRCm38) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2849:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,802,873 (GRCm38) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,749,035 (GRCm38) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,689,518 (GRCm38) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,745,025 (GRCm38) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,802,824 (GRCm38) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,586,418 (GRCm38) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,649,577 (GRCm38) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,586,965 (GRCm38) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,690,610 (GRCm38) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,573,569 (GRCm38) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,722,453 (GRCm38) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,722,369 (GRCm38) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,772,502 (GRCm38) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,658,508 (GRCm38) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,595,999 (GRCm38) splice site probably null
R4441:Hmcn1 UTSW 1 150,657,459 (GRCm38) missense probably null
R4493:Hmcn1 UTSW 1 150,701,899 (GRCm38) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,633,666 (GRCm38) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,563,780 (GRCm38) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,734,487 (GRCm38) missense probably benign
R4601:Hmcn1 UTSW 1 150,738,645 (GRCm38) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,595,894 (GRCm38) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,675,511 (GRCm38) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,624,550 (GRCm38) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,619,065 (GRCm38) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,772,571 (GRCm38) splice site probably null
R4724:Hmcn1 UTSW 1 150,694,833 (GRCm38) splice site probably null
R4737:Hmcn1 UTSW 1 150,689,595 (GRCm38) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,577,612 (GRCm38) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,593,085 (GRCm38) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,677,379 (GRCm38) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,722,535 (GRCm38) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,876,360 (GRCm38) intron probably benign
R4968:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,819,449 (GRCm38) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,680,688 (GRCm38) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,737,256 (GRCm38) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,610,669 (GRCm38) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,656,741 (GRCm38) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,646,701 (GRCm38) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,595,861 (GRCm38) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,679,514 (GRCm38) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,582,296 (GRCm38) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,755,372 (GRCm38) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,623,244 (GRCm38) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,701,972 (GRCm38) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,609,825 (GRCm38) splice site probably null
R5531:Hmcn1 UTSW 1 150,743,788 (GRCm38) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,755,291 (GRCm38) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,737,506 (GRCm38) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,577,539 (GRCm38) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,656,567 (GRCm38) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,658,562 (GRCm38) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,609,778 (GRCm38) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,690,600 (GRCm38) nonsense probably null
R5718:Hmcn1 UTSW 1 150,609,666 (GRCm38) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,694,849 (GRCm38) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,758,474 (GRCm38) splice site probably null
R5739:Hmcn1 UTSW 1 150,808,697 (GRCm38) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,573,554 (GRCm38) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,694,878 (GRCm38) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,674,347 (GRCm38) nonsense probably null
R5809:Hmcn1 UTSW 1 150,649,607 (GRCm38) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,737,524 (GRCm38) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,993,023 (GRCm38) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,630,327 (GRCm38) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,598,897 (GRCm38) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,577,296 (GRCm38) nonsense probably null
R5940:Hmcn1 UTSW 1 150,657,222 (GRCm38) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,563,817 (GRCm38) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,704,173 (GRCm38) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,802,895 (GRCm38) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,632,437 (GRCm38) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,663,909 (GRCm38) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,770,330 (GRCm38) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,755,294 (GRCm38) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,755,293 (GRCm38) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,631,227 (GRCm38) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,618,936 (GRCm38) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,722,424 (GRCm38) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,565,425 (GRCm38) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,646,784 (GRCm38) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6187:Hmcn1 UTSW 1 150,630,728 (GRCm38) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,738,681 (GRCm38) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,697,419 (GRCm38) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,697,476 (GRCm38) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,744,960 (GRCm38) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,992,919 (GRCm38) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,664,784 (GRCm38) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,677,302 (GRCm38) nonsense probably null
R6490:Hmcn1 UTSW 1 150,583,278 (GRCm38) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,697,566 (GRCm38) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6612:Hmcn1 UTSW 1 150,595,118 (GRCm38) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,723,257 (GRCm38) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,743,796 (GRCm38) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,758,306 (GRCm38) missense probably benign
R6687:Hmcn1 UTSW 1 150,745,033 (GRCm38) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,704,175 (GRCm38) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,734,518 (GRCm38) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,993,051 (GRCm38) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,599,653 (GRCm38) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,773,890 (GRCm38) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,604,102 (GRCm38) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,860,367 (GRCm38) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,604,246 (GRCm38) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,700,541 (GRCm38) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,577,210 (GRCm38) splice site probably null
R7144:Hmcn1 UTSW 1 150,663,873 (GRCm38) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,686,854 (GRCm38) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,748,993 (GRCm38) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,753,699 (GRCm38) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,649,580 (GRCm38) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,638,876 (GRCm38) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,722,643 (GRCm38) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,715,823 (GRCm38) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,582,337 (GRCm38) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,683,715 (GRCm38) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,733,129 (GRCm38) splice site probably null
R7316:Hmcn1 UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,603,814 (GRCm38) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,638,866 (GRCm38) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,683,745 (GRCm38) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,667,889 (GRCm38) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,806,445 (GRCm38) nonsense probably null
R7360:Hmcn1 UTSW 1 150,618,846 (GRCm38) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,563,631 (GRCm38) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,646,670 (GRCm38) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,674,430 (GRCm38) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,720,759 (GRCm38) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,630,266 (GRCm38) nonsense probably null
R7454:Hmcn1 UTSW 1 150,563,604 (GRCm38) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,580,267 (GRCm38) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,677,234 (GRCm38) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,622,967 (GRCm38) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,656,573 (GRCm38) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,686,780 (GRCm38) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,604,874 (GRCm38) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,655,835 (GRCm38) missense probably benign
R7588:Hmcn1 UTSW 1 150,657,134 (GRCm38) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,565,329 (GRCm38) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,646,709 (GRCm38) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,667,880 (GRCm38) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,722,445 (GRCm38) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,756,592 (GRCm38) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,770,279 (GRCm38) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,806,421 (GRCm38) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,744,971 (GRCm38) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,593,189 (GRCm38) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,664,892 (GRCm38) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,650,084 (GRCm38) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,655,855 (GRCm38) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,664,878 (GRCm38) nonsense probably null
R8015:Hmcn1 UTSW 1 150,598,311 (GRCm38) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,649,992 (GRCm38) nonsense probably null
R8072:Hmcn1 UTSW 1 150,656,505 (GRCm38) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,749,090 (GRCm38) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,859,206 (GRCm38) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,753,660 (GRCm38) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,604,954 (GRCm38) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,646,658 (GRCm38) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,722,514 (GRCm38) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,577,477 (GRCm38) nonsense probably null
R8234:Hmcn1 UTSW 1 150,594,010 (GRCm38) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,819,366 (GRCm38) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,859,254 (GRCm38) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,738,764 (GRCm38) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,738,734 (GRCm38) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,758,391 (GRCm38) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,694,920 (GRCm38) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,603,800 (GRCm38) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,580,239 (GRCm38) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,573,551 (GRCm38) nonsense probably null
R8559:Hmcn1 UTSW 1 150,676,038 (GRCm38) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,755,257 (GRCm38) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,633,620 (GRCm38) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,680,662 (GRCm38) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,664,885 (GRCm38) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,715,718 (GRCm38) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,734,497 (GRCm38) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,655,819 (GRCm38) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,671,975 (GRCm38) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,638,908 (GRCm38) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,649,972 (GRCm38) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,773,779 (GRCm38) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,755,044 (GRCm38) intron probably benign
R9030:Hmcn1 UTSW 1 150,817,119 (GRCm38) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,689,569 (GRCm38) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,657,118 (GRCm38) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,697,580 (GRCm38) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,598,390 (GRCm38) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,630,341 (GRCm38) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,612,654 (GRCm38) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,624,586 (GRCm38) nonsense probably null
R9204:Hmcn1 UTSW 1 150,734,511 (GRCm38) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,719,093 (GRCm38) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,597,989 (GRCm38) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,630,295 (GRCm38) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,669,436 (GRCm38) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,630,302 (GRCm38) nonsense probably null
R9464:Hmcn1 UTSW 1 150,723,497 (GRCm38) missense possibly damaging 0.80
R9476:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,734,530 (GRCm38) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,704,220 (GRCm38) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,595,239 (GRCm38) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,669,424 (GRCm38) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,622,909 (GRCm38) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,599,552 (GRCm38) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,679,595 (GRCm38) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,808,722 (GRCm38) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,630,303 (GRCm38) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,743,741 (GRCm38) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,737,605 (GRCm38) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,609,627 (GRCm38) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,798,815 (GRCm38) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,748,190 (GRCm38) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,756,588 (GRCm38) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,992,874 (GRCm38) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,722,629 (GRCm38) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,652,582 (GRCm38) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,808,640 (GRCm38) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,624,561 (GRCm38) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,635,146 (GRCm38) nonsense probably null
X0022:Hmcn1 UTSW 1 150,700,530 (GRCm38) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,860,376 (GRCm38) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,663,901 (GRCm38) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,648,937 (GRCm38) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,663,917 (GRCm38) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,655,921 (GRCm38) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,586,445 (GRCm38) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- AAACACTGGCTTTGTCTTGTTC -3'
(R):5'- GTGGCGCTGTAAATACGTCTC -3'

Sequencing Primer
(F):5'- ACACTGGCTTTGTCTTGTTCATAATG -3'
(R):5'- GGCGCTGTAAATACGTCTCATCTG -3'
Posted On 2022-06-15