Incidental Mutation 'R9474:Hmcn1'
ID 715604
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms LOC240793, EG545370
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 150562524-150993435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 150630720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 3779 (R3779W)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: R3779W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: R3779W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: R3779W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: R3779W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Emc1 T A 4: 139,366,394 L605Q probably damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Inhba A C 13: 16,017,678 E128A probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Myh13 G A 11: 67,364,886 S34N Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Rp1 A G 1: 4,092,615 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zfpm2 T A 15: 41,103,471 S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150677278 missense probably benign
IGL00571:Hmcn1 APN 1 150638999 missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150806366 critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150664936 missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150656734 missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150630340 missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150610713 missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150605006 missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150582301 missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150638869 missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150627033 missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150632552 splice site probably benign
IGL01304:Hmcn1 APN 1 150622924 missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150745001 missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150719240 missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150593097 missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150859239 missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150605072 missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150609631 missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150598397 missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150627413 missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150672032 missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150580233 missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150737299 missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150583280 missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150744960 missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150672038 missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150615300 missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150690601 missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150742260 splice site probably benign
IGL01906:Hmcn1 APN 1 150667887 missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150732892 missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150603871 missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150615298 missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150704181 missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150630728 missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150722607 missense probably benign
IGL02155:Hmcn1 APN 1 150563598 missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150806401 missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150664915 missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150802897 missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150722424 missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150993023 missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150809726 missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150697493 missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150744995 missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150619009 missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150604903 missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150656694 nonsense probably null
IGL02735:Hmcn1 APN 1 150646832 missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150563828 missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150675974 critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150577278 missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150657207 missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150697522 missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150671917 missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150808539 missense probably benign
IGL03195:Hmcn1 APN 1 150802909 missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150743667 missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150770352 splice site probably benign
IGL03268:Hmcn1 APN 1 150772510 missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150598424 missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150630231 missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150732910 missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150701969 missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150663872 missense probably damaging 1.00
Backbone UTSW 1 150622994 missense probably benign 0.09
Cambrian UTSW 1 150732846 missense probably damaging 1.00
chordate UTSW 1 150587015 missense probably benign 0.00
Justamere UTSW 1 150588257 missense probably damaging 1.00
Lancelet UTSW 1 150675540 missense probably benign 0.00
notochord UTSW 1 150770293 missense probably benign 0.00
wippoorwill UTSW 1 150732946 missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150738658 missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150720689 missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150808737 missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150669487 missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150808676 missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150652551 missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150677406 missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150587015 missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150808647 missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150677324 missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150663879 missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150603811 missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150798814 missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150715822 missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150732792 splice site probably benign
R0503:Hmcn1 UTSW 1 150859252 missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150876419 splice site probably benign
R0506:Hmcn1 UTSW 1 150742341 missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150719117 missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150650017 nonsense probably null
R0599:Hmcn1 UTSW 1 150609801 missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150657376 critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150594016 missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150798719 splice site probably null
R0699:Hmcn1 UTSW 1 150819410 missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150808787 missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150753665 missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150650073 missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150679607 splice site probably null
R0975:Hmcn1 UTSW 1 150577377 missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1233:Hmcn1 UTSW 1 150749026 missense probably benign
R1234:Hmcn1 UTSW 1 150753654 nonsense probably null
R1291:Hmcn1 UTSW 1 150748191 missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150680715 missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150646794 missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150652506 splice site probably benign
R1458:Hmcn1 UTSW 1 150609700 missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150772552 missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150669421 missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150773803 missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150734532 missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150657241 missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150745027 missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150669558 missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150630333 missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150565369 nonsense probably null
R1710:Hmcn1 UTSW 1 150675984 missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150859186 missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150599030 missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150563568 missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150749083 missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150598285 missense probably benign 0.00
R1794:Hmcn1 UTSW 1 150627152 missense probably damaging 0.98
R1856:Hmcn1 UTSW 1 150721664 missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150657193 missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150603812 missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150720695 missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150577295 missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150657451 missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150992855 missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150604882 missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150649676 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150675991 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150677376 missense possibly damaging 0.72
R2001:Hmcn1 UTSW 1 150738613 missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150677334 missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150577323 missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150633659 missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150715815 missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150599010 missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150624598 splice site probably benign
R2303:Hmcn1 UTSW 1 150704226 missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150652678 splice site probably benign
R2338:Hmcn1 UTSW 1 150622934 missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150565384 missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150860341 missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150599032 missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150615221 missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150686867 nonsense probably null
R2519:Hmcn1 UTSW 1 150773820 nonsense probably null
R2520:Hmcn1 UTSW 1 150743647 missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150652575 missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150630652 critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150563599 nonsense probably null
R2849:Hmcn1 UTSW 1 150563599 nonsense probably null
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150802873 missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150749035 missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150689518 missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150745025 missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150802824 missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150622994 missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150586418 missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150649577 critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150586965 missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150690610 missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150573569 missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150722453 missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150722369 missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150772502 missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150658508 missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150595999 splice site probably null
R4441:Hmcn1 UTSW 1 150657459 missense probably null
R4493:Hmcn1 UTSW 1 150701899 missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150633666 missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150563780 missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150734487 missense probably benign
R4601:Hmcn1 UTSW 1 150738645 missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150595894 missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150675511 critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150624550 missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150619065 missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150772571 splice site probably null
R4724:Hmcn1 UTSW 1 150694833 splice site probably null
R4737:Hmcn1 UTSW 1 150689595 missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150577612 missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150593085 missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150677379 missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150722535 missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150876360 intron probably benign
R4968:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150819449 missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150680688 missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150588257 missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150737256 missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150610669 missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150656741 missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150646701 missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150595861 missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150679514 missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150582296 missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150755372 missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150623244 missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150701972 missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150675540 missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150609825 splice site probably null
R5531:Hmcn1 UTSW 1 150743788 missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150755291 missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150737506 missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150577539 missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150656567 missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150658562 missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150609778 missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150609666 missense probably damaging 1.00
R5718:Hmcn1 UTSW 1 150690600 nonsense probably null
R5723:Hmcn1 UTSW 1 150694849 missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150758474 splice site probably null
R5739:Hmcn1 UTSW 1 150808697 missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150573554 missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150694878 missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150674347 nonsense probably null
R5809:Hmcn1 UTSW 1 150649607 missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150737524 missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150993023 missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150630327 missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150598897 missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150577296 nonsense probably null
R5940:Hmcn1 UTSW 1 150657222 missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150563817 missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150704173 missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150802895 missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150632437 missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150663909 missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150770330 missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150755293 missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150755294 missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150631227 missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150618936 missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150732846 missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150722424 missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150565425 missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150646784 missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150615438 splice site probably null
R6187:Hmcn1 UTSW 1 150630728 missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150738681 missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150697419 critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150697476 missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150744960 missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150992919 missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150664784 missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150677302 nonsense probably null
R6490:Hmcn1 UTSW 1 150583278 missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150697566 missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150615438 splice site probably null
R6612:Hmcn1 UTSW 1 150595118 critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150723257 critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150743796 missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150758306 missense probably benign
R6687:Hmcn1 UTSW 1 150745033 missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150704175 missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150734518 missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150770293 missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150993051 start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150599653 critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150773890 missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150604102 missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150860367 missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150604246 missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150700541 missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150577210 splice site probably null
R7144:Hmcn1 UTSW 1 150663873 missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150686854 missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150748993 missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150753699 missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150649580 missense probably null 1.00
R7231:Hmcn1 UTSW 1 150638876 missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150722643 missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150715823 missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150582337 missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150683715 missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150733129 splice site probably null
R7316:Hmcn1 UTSW 1 150732946 missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150603814 missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150638866 missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150683745 missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150667889 missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150806445 nonsense probably null
R7360:Hmcn1 UTSW 1 150618846 missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150563631 missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150646670 missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150674430 missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150720759 missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150630266 nonsense probably null
R7454:Hmcn1 UTSW 1 150563604 missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150580267 missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150677234 critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150622967 missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150656573 missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150686780 missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150604874 missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150655835 missense probably benign
R7588:Hmcn1 UTSW 1 150657134 missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150565329 missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150646709 missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150667880 missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150722445 missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150756592 missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150770279 missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150806421 missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150744971 missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150593189 missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150664892 missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150609775 missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150650084 missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150655855 missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150664878 nonsense probably null
R8015:Hmcn1 UTSW 1 150598311 missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150649992 nonsense probably null
R8072:Hmcn1 UTSW 1 150656505 missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150749090 missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150859206 missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150753660 missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150604954 missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150646658 missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150722514 missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150577477 nonsense probably null
R8234:Hmcn1 UTSW 1 150594010 missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150819366 missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150859254 missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150738764 missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150738734 missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150758391 missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150694920 missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150603800 missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150580239 missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150573551 nonsense probably null
R8559:Hmcn1 UTSW 1 150676038 missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150755257 missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150633620 missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150680662 missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150664885 missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150715718 missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150734497 missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150655819 missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150671975 missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150638908 missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150649972 missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150773779 missense probably damaging 1.00
R9030:Hmcn1 UTSW 1 150817119 missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150689569 missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150756558 missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150657118 missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150697580 missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150598390 missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150646592 missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150630341 missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150612654 missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150624586 nonsense probably null
R9204:Hmcn1 UTSW 1 150734511 missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150719093 critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150597989 missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150756558 missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150630295 missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150646592 missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150669436 missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150630302 nonsense probably null
R9464:Hmcn1 UTSW 1 150723497 missense possibly damaging 0.80
R9476:Hmcn1 UTSW 1 150586376 missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150734530 missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150704220 missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150595239 missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150586376 missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150669424 missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150622909 missense probably benign 0.00
RF003:Hmcn1 UTSW 1 150624561 missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150635146 nonsense probably null
X0022:Hmcn1 UTSW 1 150700530 missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150860376 missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150663901 missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150648937 missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150586445 missense probably null 0.92
Z1176:Hmcn1 UTSW 1 150655921 missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150663917 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAACACTGGCTTTGTCTTGTTC -3'
(R):5'- GTGGCGCTGTAAATACGTCTC -3'

Sequencing Primer
(F):5'- ACACTGGCTTTGTCTTGTTCATAATG -3'
(R):5'- GGCGCTGTAAATACGTCTCATCTG -3'
Posted On 2022-06-15