Mutagenetix > Incidental Mutation

Incidental Mutation 'R2221:Col9a2'

241479

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040223-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2221 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 121054258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 599 (R599G)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058754

SMART Domains

Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M48_N	41	225	2.5e-70	PFAM
Pfam:Peptidase_M48	228	473	5.5e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Meta Mutation Damage Score

0.3183

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,247,457		probably null	Het
Adamtsl1	A	C	4: 86,388,525	D1392A	probably benign	Het
Afdn	T	C	17: 13,883,737		probably benign	Het
Aph1b	A	T	9: 66,784,639	M121K	probably damaging	Het
Aspg	G	A	12: 112,114,434	A120T	probably damaging	Het
Bicd1	A	G	6: 149,517,005	T725A	probably damaging	Het
Cd1d2	A	T	3: 86,988,540	I292F	probably damaging	Het
Cdk13	A	G	13: 17,719,535	V495A	probably damaging	Het
Cfd	A	T	10: 79,892,205		probably null	Het
Cradd	A	C	10: 95,175,873	V135G	probably benign	Het
Cry1	A	G	10: 85,143,753	C460R	probably damaging	Het
Ctu2	A	G	8: 122,480,910	E375G	probably damaging	Het
Dym	T	G	18: 75,230,165	I580S	probably damaging	Het
Eif3e	A	G	15: 43,251,547	L411P	possibly damaging	Het
Emsy	T	C	7: 98,590,775	E1091G	possibly damaging	Het
Enkur	A	G	2: 21,189,319		probably benign	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Frem2	G	A	3: 53,516,857	A3053V	probably benign	Het
Gbgt1	T	C	2: 28,498,423	L40P	probably damaging	Het
Gm5174	T	A	10: 86,656,508		noncoding transcript	Het
Gys2	G	T	6: 142,456,422	D230E	probably damaging	Het
Herc2	T	A	7: 56,169,018		probably null	Het
Hps3	A	T	3: 20,002,363	S815R	probably benign	Het
Igf1r	C	A	7: 68,201,962	S983R	probably damaging	Het
Itsn1	T	A	16: 91,853,768		probably benign	Het
Kcnc2	A	G	10: 112,456,526	N91D	probably damaging	Het
Kif28	C	A	1: 179,733,111	A210S	possibly damaging	Het
Klri2	T	A	6: 129,740,309	Q37L	probably damaging	Het
Lrrc38	T	A	4: 143,369,849	C243*	probably null	Het
Map3k5	T	C	10: 20,067,920	V590A	possibly damaging	Het
Mdn1	C	A	4: 32,763,306	F5135L	probably benign	Het
Megf11	G	A	9: 64,660,431	G401S	possibly damaging	Het
Mst1r	T	C	9: 107,908,348	F402L	probably damaging	Het
Ntrk3	T	C	7: 78,198,852	I759V	probably damaging	Het
Nup188	T	C	2: 30,336,924		probably benign	Het
Olfr1243	C	T	2: 89,527,937	V158I	probably benign	Het
Olfr870	T	C	9: 20,171,092	S160G	possibly damaging	Het
Prdm2	T	C	4: 143,134,899	N607S	possibly damaging	Het
Prl2a1	T	A	13: 27,806,386		probably null	Het
Serpina9	T	A	12: 103,998,264	I305F	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc19a1	C	T	10: 77,042,486	T285I	probably benign	Het
Snap91	T	C	9: 86,792,527	T544A	possibly damaging	Het
Srgap3	A	G	6: 112,946,493	S2P	probably damaging	Het
Tcof1	A	G	18: 60,837,901	V210A	possibly damaging	Het
Tex261	A	G	6: 83,771,515	I136T	probably benign	Het
Trpa1	A	T	1: 14,903,256	F279L	probably null	Het
Ttc39b	T	C	4: 83,232,762	N532S	probably benign	Het
Ttn	T	C	2: 76,742,094	T26152A	probably damaging	Het
Ube2w	A	G	1: 16,597,959	S97P	possibly damaging	Het
Vmn1r25	A	C	6: 57,979,238	L22R	probably damaging	Het
Vmn1r64	T	C	7: 5,884,449	I32V	probably benign	Het
Vmn2r112	T	G	17: 22,601,233	M29R	possibly damaging	Het
Vmn2r71	T	A	7: 85,624,093	M705K	probably benign	Het
Vps13b	G	A	15: 35,884,597	V3139I	probably benign	Het
Zfp628	T	C	7: 4,920,831	V684A	probably benign	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTGGTACATAGTAAATGCCAG -3'
(R):5'- GAATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'

Posted On

2014-10-15