Incidental Mutation 'R9745:Zfp638'
ID 732043
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Name zinc finger protein 638
Synonyms Np220, Zfml
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83844050-83963855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83921795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 641 (S641T)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000204751] [ENSMUST00000203891] [ENSMUST00000204202]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
AA Change: S641T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113836
AA Change: S641T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect probably benign
Transcript: ENSMUST00000203324
AA Change: S641T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
AA Change: S641T

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000204751
AA Change: S641T

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203891
AA Change: S641T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204202
AA Change: S641T

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016
AA Change: S641T

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205166
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83,956,700 (GRCm39) missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83,933,680 (GRCm39) missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83,954,112 (GRCm39) missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83,906,146 (GRCm39) missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83,911,976 (GRCm39) missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83,921,780 (GRCm39) missense probably benign 0.01
IGL01570:Zfp638 APN 6 83,924,829 (GRCm39) missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83,956,508 (GRCm39) missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83,961,857 (GRCm39) missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83,946,214 (GRCm39) missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83,961,866 (GRCm39) missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83,912,000 (GRCm39) splice site probably benign
IGL03135:Zfp638 APN 6 83,919,857 (GRCm39) missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83,923,229 (GRCm39) missense probably benign 0.04
R0190:Zfp638 UTSW 6 83,905,946 (GRCm39) missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83,944,336 (GRCm39) missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83,949,220 (GRCm39) unclassified probably benign
R0938:Zfp638 UTSW 6 83,961,023 (GRCm39) missense probably benign 0.16
R1312:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83,921,638 (GRCm39) missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83,955,047 (GRCm39) splice site probably null
R1634:Zfp638 UTSW 6 83,956,894 (GRCm39) splice site probably null
R1651:Zfp638 UTSW 6 83,931,719 (GRCm39) missense probably benign 0.00
R2079:Zfp638 UTSW 6 83,930,371 (GRCm39) critical splice donor site probably null
R2134:Zfp638 UTSW 6 83,905,964 (GRCm39) missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83,963,578 (GRCm39) missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83,906,500 (GRCm39) missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83,943,421 (GRCm39) splice site probably benign
R4353:Zfp638 UTSW 6 83,961,041 (GRCm39) missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83,958,719 (GRCm39) missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83,956,544 (GRCm39) nonsense probably null
R4807:Zfp638 UTSW 6 83,920,040 (GRCm39) missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83,956,457 (GRCm39) missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83,906,438 (GRCm39) missense probably benign 0.03
R5236:Zfp638 UTSW 6 83,953,557 (GRCm39) nonsense probably null
R5323:Zfp638 UTSW 6 83,939,076 (GRCm39) missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83,953,396 (GRCm39) missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83,944,345 (GRCm39) missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83,956,170 (GRCm39) missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83,906,623 (GRCm39) missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83,920,111 (GRCm39) missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83,906,969 (GRCm39) missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83,906,054 (GRCm39) missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83,921,829 (GRCm39) missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83,954,047 (GRCm39) missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83,844,212 (GRCm39) missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83,942,560 (GRCm39) missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83,907,092 (GRCm39) missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83,930,108 (GRCm39) missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83,931,708 (GRCm39) missense probably benign 0.00
R7141:Zfp638 UTSW 6 83,844,181 (GRCm39) missense unknown
R7368:Zfp638 UTSW 6 83,906,437 (GRCm39) missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83,905,670 (GRCm39) missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83,907,127 (GRCm39) missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83,953,254 (GRCm39) missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83,956,196 (GRCm39) missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83,906,801 (GRCm39) missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83,954,391 (GRCm39) missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83,906,713 (GRCm39) missense possibly damaging 0.85
R8327:Zfp638 UTSW 6 83,905,679 (GRCm39) missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83,956,747 (GRCm39) missense probably benign 0.28
R8703:Zfp638 UTSW 6 83,954,143 (GRCm39) missense probably damaging 0.96
R8738:Zfp638 UTSW 6 83,931,745 (GRCm39) critical splice donor site probably null
R8865:Zfp638 UTSW 6 83,954,035 (GRCm39) missense possibly damaging 0.91
R8874:Zfp638 UTSW 6 83,946,135 (GRCm39) missense probably damaging 1.00
R9080:Zfp638 UTSW 6 83,844,155 (GRCm39) missense unknown
R9113:Zfp638 UTSW 6 83,953,894 (GRCm39) missense probably damaging 0.96
R9574:Zfp638 UTSW 6 83,956,680 (GRCm39) missense probably damaging 1.00
R9661:Zfp638 UTSW 6 83,923,320 (GRCm39) missense probably damaging 0.99
R9722:Zfp638 UTSW 6 83,923,301 (GRCm39) missense probably damaging 1.00
Z1088:Zfp638 UTSW 6 83,921,793 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGTTCTGTGCATGGGAC -3'
(R):5'- TTGAGCACAAACATTAACCATCTGG -3'

Sequencing Primer
(F):5'- TGGGACAGAAGTTACTAAACAGAAAC -3'
(R):5'- ACATTAACCATCTGGCATTCCTAATC -3'
Posted On 2022-11-14