Incidental Mutation 'R0904:Ss18l1'
ID 83237
Institutional Source Beutler Lab
Gene Symbol Ss18l1
Ensembl Gene ENSMUSG00000039086
Gene Name SS18, nBAF chromatin remodeling complex subunit like 1
Synonyms CREST, A230053O16Rik
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock # R0904 (G1)
Quality Score 170
Status Validated
Chromosome 2
Chromosomal Location 180042509-180070201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180059354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000041288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041126]
AlphaFold Q8BW22
Predicted Effect probably damaging
Transcript: ENSMUST00000041126
AA Change: Y287C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: Y287C

DomainStartEndE-ValueType
Pfam:SSXT 13 74 4.3e-35 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 215 238 N/A INTRINSIC
low complexity region 244 251 N/A INTRINSIC
low complexity region 311 375 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
Meta Mutation Damage Score 0.4253 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Ss18l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0781:Ss18l1 UTSW 2 180055854 missense possibly damaging 0.57
R1938:Ss18l1 UTSW 2 180063345 missense unknown
R2853:Ss18l1 UTSW 2 180058121 missense probably damaging 1.00
R3825:Ss18l1 UTSW 2 180063310 missense unknown
R4907:Ss18l1 UTSW 2 180063399 critical splice donor site probably null
R5256:Ss18l1 UTSW 2 180061942 missense unknown
R5508:Ss18l1 UTSW 2 180057653 missense probably damaging 0.96
R6216:Ss18l1 UTSW 2 180061913 missense unknown
R6218:Ss18l1 UTSW 2 180055112 missense probably benign 0.00
R7529:Ss18l1 UTSW 2 180058157 missense possibly damaging 0.80
R8192:Ss18l1 UTSW 2 180059362 missense probably damaging 0.98
R8498:Ss18l1 UTSW 2 180058175 missense probably damaging 0.96
R8830:Ss18l1 UTSW 2 180067338 missense unknown
Predicted Primers PCR Primer
(F):5'- CATCCGCAGTTTACAGGTGGAGAG -3'
(R):5'- CACTGTTTGCCAAATGCACGAGG -3'

Sequencing Primer
(F):5'- agagggagagagagagagaac -3'
(R):5'- CAATGACGCGGCTGAGAC -3'
Posted On 2013-11-08