Mutagenetix > Incidental Mutation

Incidental Mutation 'W0251:Cfap46'

166606

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik, Ttc40

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

W0251 (G3R) of strain daniel_gray

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

139180867-139263733 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139183862 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 2507 (M2507V)

Ref Sequence

ENSEMBL: ENSMUSP00000120186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990]

AlphaFold

E9Q2C0

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093991

SMART Domains

Protein: ENSMUSP00000091527
Gene: ENSMUSG00000070357

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C50	21	290	9.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129990
AA Change: M2507V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: M2507V

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166503

SMART Domains

Protein: ENSMUSP00000126077
Gene: ENSMUSG00000070357

Domain	Start	End	E-Value	Type
low complexity region	31	50	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196540
AA Change: M62V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl2a1b	T	A	9: 89,081,636 (GRCm39)	M75K	probably damaging	Het
Btaf1	G	A	19: 36,980,904 (GRCm39)	R1575H	probably damaging	Het
Dcc	T	C	18: 71,959,154 (GRCm39)	D206G	probably damaging	Het
Dnah6	T	A	6: 73,155,501 (GRCm39)	I705F	possibly damaging	Het
Entpd1	A	T	19: 40,714,697 (GRCm39)	I269F	probably damaging	Het
Gm4559	G	C	7: 141,827,535 (GRCm39)	A189G	unknown	Het
Ipo5	T	A	14: 121,176,197 (GRCm39)	M648K	probably benign	Het
Kdelr1	A	G	7: 45,531,045 (GRCm39)	Y96C	probably damaging	Het
Mmp17	C	T	5: 129,672,591 (GRCm39)	A181V	probably benign	Het
Muc20	T	C	16: 32,614,223 (GRCm39)	I385V	possibly damaging	Het
Or13c7	C	T	4: 43,855,058 (GRCm39)	L250F	probably benign	Het
Pik3r6	A	G	11: 68,424,697 (GRCm39)	Y434C	probably benign	Het
Pura	T	C	18: 36,420,843 (GRCm39)	V210A	probably benign	Het
Spic	C	T	10: 88,515,766 (GRCm39)	D19N	probably damaging	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139,240,605 (GRCm39)	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139,194,359 (GRCm39)	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139,240,605 (GRCm39)	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139,240,605 (GRCm39)	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139,240,605 (GRCm39)	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139,246,895 (GRCm39)	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139,186,523 (GRCm39)	missense	unknown
IGL02171:Cfap46	APN	7	139,246,972 (GRCm39)	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139,262,425 (GRCm39)	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139,194,386 (GRCm39)	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139,187,117 (GRCm39)	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139,183,168 (GRCm39)	missense	unknown
IGL03329:Cfap46	APN	7	139,181,081 (GRCm39)	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139,218,711 (GRCm39)	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139,218,846 (GRCm39)	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139,218,846 (GRCm39)	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139,225,467 (GRCm39)	missense
R0051:Cfap46	UTSW	7	139,255,951 (GRCm39)	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139,255,951 (GRCm39)	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139,234,482 (GRCm39)	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139,231,449 (GRCm39)	splice site	probably benign
R0650:Cfap46	UTSW	7	139,185,571 (GRCm39)	missense	unknown
R0675:Cfap46	UTSW	7	139,255,950 (GRCm39)	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139,234,586 (GRCm39)	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139,235,757 (GRCm39)	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139,222,513 (GRCm39)	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139,181,181 (GRCm39)	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139,234,545 (GRCm39)	nonsense	probably null
R1538:Cfap46	UTSW	7	139,262,924 (GRCm39)	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139,232,726 (GRCm39)	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139,222,436 (GRCm39)	nonsense	probably null
R1824:Cfap46	UTSW	7	139,219,518 (GRCm39)	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139,220,323 (GRCm39)	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139,233,324 (GRCm39)	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139,263,386 (GRCm39)	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139,259,819 (GRCm39)	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139,246,957 (GRCm39)	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139,263,677 (GRCm39)	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139,240,962 (GRCm39)	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139,233,414 (GRCm39)	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139,197,506 (GRCm39)	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139,219,515 (GRCm39)	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139,258,467 (GRCm39)	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139,246,203 (GRCm39)	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139,246,203 (GRCm39)	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139,232,589 (GRCm39)	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139,230,868 (GRCm39)	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139,239,998 (GRCm39)	intron	probably benign
R4595:Cfap46	UTSW	7	139,232,320 (GRCm39)	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139,260,843 (GRCm39)	missense	probably damaging	1.00
R4627:Cfap46	UTSW	7	139,237,197 (GRCm39)	missense	probably damaging	0.99
R4628:Cfap46	UTSW	7	139,260,843 (GRCm39)	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139,260,843 (GRCm39)	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139,207,372 (GRCm39)	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139,259,239 (GRCm39)	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139,210,524 (GRCm39)	missense	probably null
R4779:Cfap46	UTSW	7	139,239,731 (GRCm39)	intron	probably benign
R4812:Cfap46	UTSW	7	139,215,916 (GRCm39)	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139,187,104 (GRCm39)	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139,207,291 (GRCm39)	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139,183,776 (GRCm39)	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139,241,106 (GRCm39)	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139,258,430 (GRCm39)	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139,193,423 (GRCm39)	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139,230,802 (GRCm39)	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139,207,389 (GRCm39)	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139,212,097 (GRCm39)	splice site	probably null
R5642:Cfap46	UTSW	7	139,258,493 (GRCm39)	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139,218,269 (GRCm39)	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139,186,616 (GRCm39)	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139,191,947 (GRCm39)	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139,230,858 (GRCm39)	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139,231,511 (GRCm39)	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139,218,816 (GRCm39)	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139,236,496 (GRCm39)	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139,218,816 (GRCm39)	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139,218,816 (GRCm39)	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139,241,001 (GRCm39)	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139,260,747 (GRCm39)	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139,194,321 (GRCm39)	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139,199,887 (GRCm39)	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139,232,356 (GRCm39)	missense	probably damaging	1.00
R6773:Cfap46	UTSW	7	139,222,477 (GRCm39)	utr 3 prime	probably benign
R6835:Cfap46	UTSW	7	139,232,414 (GRCm39)	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139,234,477 (GRCm39)	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139,219,616 (GRCm39)	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139,197,994 (GRCm39)	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139,197,493 (GRCm39)	missense	unknown
R7327:Cfap46	UTSW	7	139,215,062 (GRCm39)	splice site	probably null
R7336:Cfap46	UTSW	7	139,200,020 (GRCm39)	missense	unknown
R7337:Cfap46	UTSW	7	139,210,492 (GRCm39)	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139,230,753 (GRCm39)	nonsense	probably null
R7450:Cfap46	UTSW	7	139,197,353 (GRCm39)	missense	unknown
R7495:Cfap46	UTSW	7	139,183,112 (GRCm39)	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139,183,155 (GRCm39)	missense
R7623:Cfap46	UTSW	7	139,198,266 (GRCm39)	missense	unknown
R7765:Cfap46	UTSW	7	139,231,480 (GRCm39)	missense
R7971:Cfap46	UTSW	7	139,215,043 (GRCm39)	missense	unknown
R8211:Cfap46	UTSW	7	139,213,220 (GRCm39)	missense	unknown
R8306:Cfap46	UTSW	7	139,236,496 (GRCm39)	missense
R8354:Cfap46	UTSW	7	139,233,414 (GRCm39)	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139,263,000 (GRCm39)	nonsense	probably null
R8447:Cfap46	UTSW	7	139,260,902 (GRCm39)	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139,185,560 (GRCm39)	missense
R8805:Cfap46	UTSW	7	139,211,979 (GRCm39)	missense	unknown
R8830:Cfap46	UTSW	7	139,195,565 (GRCm39)	missense	unknown
R8912:Cfap46	UTSW	7	139,260,097 (GRCm39)	intron	probably benign
R8920:Cfap46	UTSW	7	139,232,442 (GRCm39)	missense
R8977:Cfap46	UTSW	7	139,259,849 (GRCm39)	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139,207,259 (GRCm39)	missense	unknown
R9224:Cfap46	UTSW	7	139,258,416 (GRCm39)	nonsense	probably null
R9243:Cfap46	UTSW	7	139,195,265 (GRCm39)	intron	probably benign
R9252:Cfap46	UTSW	7	139,198,165 (GRCm39)	missense	unknown
R9276:Cfap46	UTSW	7	139,201,207 (GRCm39)	missense	unknown
R9301:Cfap46	UTSW	7	139,222,461 (GRCm39)	missense
R9391:Cfap46	UTSW	7	139,198,027 (GRCm39)	missense	unknown
R9402:Cfap46	UTSW	7	139,215,865 (GRCm39)	missense	unknown
R9443:Cfap46	UTSW	7	139,195,023 (GRCm39)	missense
R9564:Cfap46	UTSW	7	139,231,471 (GRCm39)	missense
R9625:Cfap46	UTSW	7	139,230,805 (GRCm39)	missense
R9626:Cfap46	UTSW	7	139,230,805 (GRCm39)	missense
R9638:Cfap46	UTSW	7	139,209,763 (GRCm39)	missense	unknown
R9656:Cfap46	UTSW	7	139,235,816 (GRCm39)	missense
R9658:Cfap46	UTSW	7	139,246,229 (GRCm39)	missense
R9747:Cfap46	UTSW	7	139,191,907 (GRCm39)	missense	unknown
RF023:Cfap46	UTSW	7	139,218,834 (GRCm39)
X0018:Cfap46	UTSW	7	139,260,828 (GRCm39)	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139,183,363 (GRCm39)	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139,214,980 (GRCm39)	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139,219,464 (GRCm39)	missense
Z1177:Cfap46	UTSW	7	139,210,542 (GRCm39)	missense	unknown
Z1177:Cfap46	UTSW	7	139,181,183 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCGTTCTCAATCTCGCCCACAAAAG -3'
(R):5'- GCTCGGAAGAATTAGAAGTGGCCC -3'

Sequencing Primer
(F):5'- AATCCCTTAAGTGGCAGCTC -3'
(R):5'- AATTAGAAGTGGCCCTGAGTAG -3'

Posted On

2014-04-13