Mutagenetix > Incidental Mutation

Incidental Mutation 'R1908:St5'

210056

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

039927-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.486) question?

Stock #

R1908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 109525326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 686 (Q686*)

Ref Sequence

ENSEMBL: ENSMUSP00000130119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000143107] [ENSMUST00000156921] [ENSMUST00000168005]

AlphaFold

Q924W7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053298

Predicted Effect

probably null
Transcript: ENSMUST00000077909
AA Change: Q1103*

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: Q1103*

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079282
AA Change: Q1103*

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: Q1103*

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084738
AA Change: Q686*

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: Q686*

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132877

Predicted Effect

probably benign
Transcript: ENSMUST00000143107

SMART Domains

Protein: ENSMUSP00000123410
Gene: ENSMUSG00000046364

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18e	26	146	7.2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156921

Predicted Effect

probably null
Transcript: ENSMUST00000168005
AA Change: Q686*

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: Q686*

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207664

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,226,575	D292E	probably damaging	Het
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
Abca8b	C	A	11: 109,957,098	L852F	possibly damaging	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Alg11	T	G	8: 22,065,568	C240G	probably damaging	Het
Aox1	A	G	1: 58,102,624	I1190V	probably damaging	Het
Apc2	T	G	10: 80,314,844	S1911A	probably benign	Het
Arfgef3	T	C	10: 18,652,763	D292G	possibly damaging	Het
Arhgef4	C	A	1: 34,724,259	S865R	probably benign	Het
Ass1	T	A	2: 31,493,148	Y190*	probably null	Het
B4galnt3	A	T	6: 120,210,090		probably null	Het
Btnl10	C	A	11: 58,920,541	P230Q	possibly damaging	Het
C3	A	G	17: 57,209,489	Y1348H	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cic	C	A	7: 25,286,840	T1229K	probably damaging	Het
Clip4	T	C	17: 71,837,749	S524P	probably damaging	Het
Col6a3	A	C	1: 90,811,699	I269R	probably damaging	Het
Dbh	C	T	2: 27,181,494	T533I	possibly damaging	Het
Dcaf17	A	T	2: 71,060,369	R83*	probably null	Het
Dnah1	A	G	14: 31,262,558	L3923P	probably damaging	Het
Dnah7a	A	T	1: 53,631,562	D510E	probably benign	Het
Dock6	A	G	9: 21,841,629	F296S	probably damaging	Het
Eif4enif1	T	C	11: 3,227,455	S341P	probably damaging	Het
Epb41l1	G	T	2: 156,510,817	G461V	possibly damaging	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Gm10684	A	G	9: 45,110,213		probably benign	Het
Gm12185	T	C	11: 48,915,404	E320G	probably benign	Het
Gm14412	G	T	2: 177,315,476	H209N	probably damaging	Het
Gm14412	A	C	2: 177,315,837	S88R	probably benign	Het
Grhl1	T	A	12: 24,608,556	L400Q	probably damaging	Het
Havcr1	T	A	11: 46,773,684	Y216*	probably null	Het
Hephl1	A	C	9: 15,074,124	Y745*	probably null	Het
Hmcn2	T	G	2: 31,411,910		probably null	Het
Hs3st6	A	G	17: 24,758,136	K197E	possibly damaging	Het
Ifi214	C	T	1: 173,529,511	V9I	probably benign	Het
Jakmip2	T	C	18: 43,567,144	T450A	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Macf1	A	T	4: 123,457,841	H1634Q	possibly damaging	Het
Mcpt8	T	A	14: 56,083,834	I58F	probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Myo10	T	A	15: 25,801,222	V1499E	probably damaging	Het
Myom2	G	T	8: 15,081,023	D320Y	probably damaging	Het
Olfr1220	G	A	2: 89,097,544	P128S	probably damaging	Het
Olfr1395	A	C	11: 49,148,274	N6H	possibly damaging	Het
Olfr458	C	T	6: 42,460,426	V198M	probably benign	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr74	A	T	2: 87,974,059	V202D	possibly damaging	Het
Olfr740	T	A	14: 50,453,838	M262K	probably damaging	Het
Pabpc4	G	T	4: 123,289,068	R166L	possibly damaging	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prdm15	G	T	16: 97,837,685	D58E	probably benign	Het
Rgl2	A	G	17: 33,932,148	T117A	probably benign	Het
Rp1	A	G	1: 4,348,720	I723T	probably damaging	Het
Serpina3g	A	G	12: 104,241,277	E233G	probably damaging	Het
Skint6	T	A	4: 112,891,990	S798C	probably benign	Het
Slc35f1	T	C	10: 53,021,904	L137P	possibly damaging	Het
Slc6a20a	T	C	9: 123,656,308	N246S	probably damaging	Het
Slc7a2	T	C	8: 40,916,497	L663S	probably benign	Het
Slco1a4	A	G	6: 141,815,447		probably null	Het
Slit2	A	G	5: 48,281,988	T41A	probably damaging	Het
Smc2	T	C	4: 52,450,863	I227T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Ssu2	A	T	6: 112,384,427	L23M	probably benign	Het
Syne2	A	G	12: 76,094,279		probably null	Het
Tekt1	T	C	11: 72,351,935	T249A	probably benign	Het
Tfr2	T	C	5: 137,571,692	V120A	probably benign	Het
Thsd7b	C	T	1: 129,678,109	P529L	probably damaging	Het
Tll1	C	T	8: 64,025,107	D871N	probably damaging	Het
Tlr11	A	C	14: 50,361,207	I217L	probably benign	Het
Tmem87b	T	A	2: 128,831,559	V241D	probably damaging	Het
Tshz2	T	A	2: 169,885,545	I218N	possibly damaging	Het
Vmn1r18	A	T	6: 57,390,041	I176N	possibly damaging	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vmn2r74	T	C	7: 85,952,442	T663A	probably benign	Het
Vmn2r8	T	C	5: 108,797,570	T724A	probably benign	Het
Wdr11	T	C	7: 129,605,230	V289A	possibly damaging	Het
Zfp62	T	A	11: 49,216,220	D379E	probably damaging	Het
Zfp78	C	T	7: 6,378,898	P316S	probably damaging	Het
Zfyve27	T	G	19: 42,171,548	M1R	probably null	Het
Zkscan8	G	A	13: 21,525,155	P191L	probably damaging	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9361:St5	UTSW	7	109527784	missense	probably damaging	1.00
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGAATCTTCTGCCAAATGCTC -3'
(R):5'- AGCTAAGGAAGTGTCGAGCC -3'

Sequencing Primer
(F):5'- TCTTCTGCCAAATGCTCTTAAAG -3'
(R):5'- GGGGCTTCTCTAGACTCAGTATAAC -3'

Posted On

2014-06-30