Incidental Mutation 'R1894:Sorcs3'
ID 211846
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 039914-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1894 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48782713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1076 (Q1076L)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably benign
Transcript: ENSMUST00000078880
AA Change: Q1076L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: Q1076L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T C 4: 129,907,419 (GRCm39) F977S probably damaging Het
Ago4 A G 4: 126,406,393 (GRCm39) Y306H probably benign Het
Cblc T C 7: 19,526,502 (GRCm39) T196A probably damaging Het
Cfap52 T A 11: 67,844,445 (GRCm39) probably null Het
Cops3 T C 11: 59,710,844 (GRCm39) N375S probably benign Het
Crb1 T C 1: 139,170,931 (GRCm39) T759A probably benign Het
Dnah3 T C 7: 119,685,557 (GRCm39) K153E probably benign Het
Elovl1 C T 4: 118,287,945 (GRCm39) S27F probably damaging Het
Erc2 A G 14: 27,863,185 (GRCm39) E804G probably damaging Het
Fam110b G T 4: 5,798,840 (GRCm39) C86F probably damaging Het
Fbn1 T A 2: 125,236,541 (GRCm39) R380W probably damaging Het
Gatad2a C T 8: 70,369,301 (GRCm39) R221Q probably damaging Het
Gcn1 C T 5: 115,727,174 (GRCm39) P677L probably damaging Het
Gm6020 C T 19: 61,172,391 (GRCm39) H22Y possibly damaging Het
Gm9817 T C 13: 45,232,605 (GRCm39) V136A unknown Het
Gmip T A 8: 70,273,622 (GRCm39) L971H probably damaging Het
Gnptab G A 10: 88,254,989 (GRCm39) E192K possibly damaging Het
Grm7 G A 6: 111,335,568 (GRCm39) V660I probably benign Het
Helz2 G A 2: 180,876,082 (GRCm39) P1471S probably damaging Het
Herc1 G A 9: 66,386,743 (GRCm39) G3786S probably damaging Het
Isg20 T C 7: 78,569,647 (GRCm39) V206A probably benign Het
Jund T A 8: 71,152,470 (GRCm39) I255N probably damaging Het
Kcnt2 A T 1: 140,353,079 (GRCm39) I263F probably damaging Het
Kif2c A T 4: 117,019,420 (GRCm39) L561Q probably benign Het
Klhl3 T C 13: 58,157,189 (GRCm39) D546G probably damaging Het
Klk1b4 A T 7: 43,859,054 (GRCm39) Q24L probably benign Het
Ltbp2 A T 12: 84,834,735 (GRCm39) C225S probably damaging Het
Mcub T C 3: 129,728,312 (GRCm39) H55R probably benign Het
Mecp2 C T X: 73,080,781 (GRCm39) A79T probably damaging Het
Med18 G A 4: 132,187,242 (GRCm39) R86* probably null Het
Mfsd2b T C 12: 4,919,155 (GRCm39) E63G probably damaging Het
Mtus1 C T 8: 41,537,362 (GRCm39) S118N probably damaging Het
Mybbp1a C T 11: 72,336,863 (GRCm39) T565I probably benign Het
Myo15b G A 11: 115,777,899 (GRCm39) G1049S probably damaging Het
Nfrkb T A 9: 31,326,064 (GRCm39) V1169E probably benign Het
Nr2f2 T A 7: 70,004,419 (GRCm39) M411L probably benign Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Nup214 A T 2: 31,886,392 (GRCm39) T585S possibly damaging Het
Or5m13 C T 2: 85,748,599 (GRCm39) T110I probably benign Het
Or6c214 A T 10: 129,590,943 (GRCm39) C125* probably null Het
Or7e177 T C 9: 20,211,633 (GRCm39) S47P probably benign Het
Or8b12b T A 9: 37,684,163 (GRCm39) D69E possibly damaging Het
Pih1d1 T A 7: 44,807,165 (GRCm39) I166N probably damaging Het
Prl2c5 T C 13: 13,366,263 (GRCm39) F181L probably benign Het
Prx C T 7: 27,218,535 (GRCm39) T1012I possibly damaging Het
Rassf8 T A 6: 145,754,199 (GRCm39) V5E probably damaging Het
Rassf9 C A 10: 102,380,755 (GRCm39) R44S possibly damaging Het
Relch A T 1: 105,592,301 (GRCm39) I157F probably benign Het
Sde2 G A 1: 180,687,573 (GRCm39) S153N probably benign Het
Sec16b T A 1: 157,380,545 (GRCm39) M372K possibly damaging Het
Sgcd A T 11: 47,085,937 (GRCm39) I71N probably damaging Het
Slco5a1 C T 1: 12,942,483 (GRCm39) C721Y probably damaging Het
Slx4ip A T 2: 136,910,038 (GRCm39) K344N probably benign Het
Spata21 A T 4: 140,838,692 (GRCm39) N581I possibly damaging Het
Spata31d1d G T 13: 59,875,936 (GRCm39) P533H probably benign Het
Spice1 T G 16: 44,185,989 (GRCm39) S111A probably damaging Het
Tex14 T G 11: 87,365,274 (GRCm39) F61V probably damaging Het
Timp3 C T 10: 86,181,716 (GRCm39) R196* probably null Het
Tll2 A G 19: 41,077,110 (GRCm39) probably null Het
Tppp A G 13: 74,169,326 (GRCm39) D22G possibly damaging Het
Trim24 G T 6: 37,934,013 (GRCm39) R652L probably damaging Het
Uaca T C 9: 60,777,718 (GRCm39) S702P possibly damaging Het
Uggt2 T C 14: 119,287,130 (GRCm39) E146G probably damaging Het
Vmn1r233 T C 17: 21,213,994 (GRCm39) S319G probably benign Het
Wdr47 A T 3: 108,530,692 (GRCm39) Q395L possibly damaging Het
Wrnip1 A G 13: 32,989,319 (GRCm39) probably null Het
Zfp420 A T 7: 29,573,933 (GRCm39) H51L probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCTGGCTAATAATGTGGATGC -3'
(R):5'- GATGTTGGTGCCAGAGTCAC -3'

Sequencing Primer
(F):5'- ATAATGTGGATGCCTGACCC -3'
(R):5'- AGTCACTGGGTAATTGGTAAGC -3'
Posted On 2014-06-30