Incidental Mutation 'R2097:Tspan13'
ID 230326
Institutional Source Beutler Lab
Gene Symbol Tspan13
Ensembl Gene ENSMUSG00000020577
Gene Name tetraspanin 13
Synonyms Tm4sf13, 1100001I23Rik
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 36014557-36042500 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36021830 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 128 (S128G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020896] [ENSMUST00000220641] [ENSMUST00000222584]
AlphaFold Q9D8C2
Predicted Effect probably benign
Transcript: ENSMUST00000020896
AA Change: S133G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020896
Gene: ENSMUSG00000020577
AA Change: S133G

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 194 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138393
AA Change: S128G

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121445
Gene: ENSMUSG00000020577
AA Change: S128G

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 133 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220641
Predicted Effect probably benign
Transcript: ENSMUST00000222584
AA Change: S128G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Tspan13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1875:Tspan13 UTSW 12 36020551 splice site probably null
R5149:Tspan13 UTSW 12 36024066 missense probably damaging 1.00
R6403:Tspan13 UTSW 12 36015705 missense probably damaging 1.00
R9722:Tspan13 UTSW 12 36024018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGATGTATCTCTCCGGACATAG -3'
(R):5'- TATGCTCTGCTCCTAGCTGCAG -3'

Sequencing Primer
(F):5'- GTATCTCTCCGGACATAGATGAGC -3'
(R):5'- CAGGCTGGCCTCTGTATGTTAC -3'
Posted On 2014-09-18