Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Cnga1'

230308

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.336) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 72619061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 20 (V20I)

Ref Sequence

ENSEMBL: ENSMUSP00000143377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000135701] [ENSMUST00000169997] [ENSMUST00000201463]

AlphaFold

P29974

Predicted Effect

probably benign
Transcript: ENSMUST00000087213
AA Change: V20I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: V20I

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126799
AA Change: V20I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000135701
AA Change: V20I

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000169997
AA Change: V20I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: V20I

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000201463
AA Change: V20I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: V20I

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Meta Mutation Damage Score

0.1008

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
tintoretto	UTSW	5	72609500	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
R7922:Cnga1	UTSW	5	72604882	missense	possibly damaging	0.81
R7938:Cnga1	UTSW	5	72604254	missense	probably benign	0.27
R7994:Cnga1	UTSW	5	72604660	missense	probably damaging	1.00
R8249:Cnga1	UTSW	5	72605394	missense	probably benign	0.02
R8690:Cnga1	UTSW	5	72604492	missense	probably benign	0.15
R9689:Cnga1	UTSW	5	72604827	missense	probably benign	0.10
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00
Z1177:Cnga1	UTSW	5	72605530	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGATGAACAAGTTATACTGTCCC -3'
(R):5'- ACCACAGCTGGCATACTTCG -3'

Sequencing Primer
(F):5'- GTCCCAGAGTATAAATAAATTCAC -3'
(R):5'- GCATACTTCGCCTCCTCAGTAGAG -3'

Posted On

2014-09-18