Incidental Mutation 'R2097:Zfp777'
ID 230310
Institutional Source Beutler Lab
Gene Symbol Zfp777
Ensembl Gene ENSMUSG00000071477
Gene Name zinc finger protein 777
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 48024188-48048911 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48044242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 149 (D149N)
Ref Sequence ENSEMBL: ENSMUSP00000117227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095944] [ENSMUST00000114583] [ENSMUST00000125385] [ENSMUST00000147281]
AlphaFold B9EKF4
Predicted Effect probably benign
Transcript: ENSMUST00000095944
AA Change: D149N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093637
Gene: ENSMUSG00000071477
AA Change: D149N

DomainStartEndE-ValueType
Pfam:DUF3669 177 256 4.3e-12 PFAM
KRAB 284 344 1.6e-29 SMART
low complexity region 422 433 N/A INTRINSIC
coiled coil region 454 477 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 539 555 N/A INTRINSIC
ZnF_C2H2 557 579 1.2e-5 SMART
ZnF_C2H2 585 607 3.8e-5 SMART
ZnF_C2H2 646 668 1.1e-6 SMART
ZnF_C2H2 674 696 4.6e-6 SMART
ZnF_C2H2 704 726 3.2e-7 SMART
ZnF_C2H2 732 754 3.3e-6 SMART
ZnF_C2H2 760 782 8.4e-6 SMART
ZnF_C2H2 788 810 4.9e-5 SMART
ZnF_C2H2 816 838 1.1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114583
AA Change: D193N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110230
Gene: ENSMUSG00000071477
AA Change: D193N

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:DUF3669 231 298 4.7e-12 PFAM
KRAB 328 388 3.96e-27 SMART
low complexity region 466 477 N/A INTRINSIC
coiled coil region 498 521 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
low complexity region 583 599 N/A INTRINSIC
ZnF_C2H2 601 623 2.95e-3 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 690 712 2.43e-4 SMART
ZnF_C2H2 718 740 1.12e-3 SMART
ZnF_C2H2 748 770 7.49e-5 SMART
ZnF_C2H2 776 798 7.9e-4 SMART
ZnF_C2H2 804 826 1.95e-3 SMART
ZnF_C2H2 832 854 1.18e-2 SMART
ZnF_C2H2 860 882 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125385
Predicted Effect probably benign
Transcript: ENSMUST00000147281
AA Change: D149N

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect unknown
Transcript: ENSMUST00000148362
AA Change: D1N
SMART Domains Protein: ENSMUSP00000116303
Gene: ENSMUSG00000071477
AA Change: D1N

DomainStartEndE-ValueType
Pfam:DUF3669 40 107 6.1e-13 PFAM
KRAB 137 197 3.96e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203645
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Zfp777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Zfp777 APN 6 48043984 missense probably damaging 1.00
IGL01916:Zfp777 APN 6 48025342 missense probably damaging 1.00
IGL01959:Zfp777 APN 6 48044341 missense probably benign
IGL02167:Zfp777 APN 6 48044526 missense probably damaging 0.98
IGL03150:Zfp777 APN 6 48044125 missense probably damaging 1.00
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0372:Zfp777 UTSW 6 48044476 missense possibly damaging 0.62
R0762:Zfp777 UTSW 6 48029360 missense probably damaging 1.00
R1300:Zfp777 UTSW 6 48025770 missense probably benign 0.43
R1727:Zfp777 UTSW 6 48043890 missense probably damaging 0.99
R1906:Zfp777 UTSW 6 48042061 missense probably damaging 0.99
R2047:Zfp777 UTSW 6 48044346 missense probably benign
R2211:Zfp777 UTSW 6 48043885 missense possibly damaging 0.79
R2898:Zfp777 UTSW 6 48025660 missense probably damaging 0.97
R3123:Zfp777 UTSW 6 48029116 unclassified probably benign
R3832:Zfp777 UTSW 6 48044215 missense probably benign 0.00
R4019:Zfp777 UTSW 6 48042112 missense probably damaging 1.00
R4077:Zfp777 UTSW 6 48025522 missense probably benign
R4471:Zfp777 UTSW 6 48042107 missense probably damaging 1.00
R5021:Zfp777 UTSW 6 48042127 missense probably damaging 0.99
R5030:Zfp777 UTSW 6 48037667 missense probably damaging 0.99
R5819:Zfp777 UTSW 6 48037588 missense probably damaging 0.99
R6544:Zfp777 UTSW 6 48044485 missense probably damaging 0.98
R6736:Zfp777 UTSW 6 48024856 missense probably damaging 0.99
R6971:Zfp777 UTSW 6 48024691 missense probably damaging 1.00
R7240:Zfp777 UTSW 6 48044449 missense probably benign 0.00
R7258:Zfp777 UTSW 6 48025797 missense probably damaging 0.99
R7586:Zfp777 UTSW 6 48029218 missense probably benign 0.33
R7833:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
R7947:Zfp777 UTSW 6 48024711 missense probably damaging 1.00
R8136:Zfp777 UTSW 6 48044625 missense probably benign 0.25
R8151:Zfp777 UTSW 6 48029141 nonsense probably null
R8348:Zfp777 UTSW 6 48029167 missense probably damaging 0.99
R8448:Zfp777 UTSW 6 48029167 missense probably damaging 0.99
R8942:Zfp777 UTSW 6 48029191 missense probably benign 0.25
R8983:Zfp777 UTSW 6 48029224 missense probably damaging 1.00
R9205:Zfp777 UTSW 6 48025587 missense probably benign 0.07
R9397:Zfp777 UTSW 6 48044256 missense probably benign 0.00
R9562:Zfp777 UTSW 6 48044646 missense possibly damaging 0.84
R9565:Zfp777 UTSW 6 48044646 missense possibly damaging 0.84
RF008:Zfp777 UTSW 6 48042048 nonsense probably null
Z1177:Zfp777 UTSW 6 48025234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCAGTAGTCGCATGGC -3'
(R):5'- TCTTCAGAAAGGACCTTCACTCC -3'

Sequencing Primer
(F):5'- AGTAGTCGCATGGCCTGGG -3'
(R):5'- GTATCCTGCCACTTCTGAGCAAG -3'
Posted On 2014-09-18