Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Adgrl3'

235801

Institutional Source

Beutler Lab

Gene Symbol

Adgrl3

Ensembl Gene

ENSMUSG00000037605

Gene Name

adhesion G protein-coupled receptor L3

Synonyms

LEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81020138-81825133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81512254 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 290 (K290R)

Ref Sequence

ENSEMBL: ENSMUSP00000113249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000120673] [ENSMUST00000121641] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000132375]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036068
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	6.6e-27	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	1.1e-7	PFAM
Pfam:DUF3497	627	857	2.2e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	4.4e-72	PFAM
Pfam:Latrophilin	1206	1276	2.4e-30	PFAM
Pfam:Latrophilin	1272	1543	3.2e-113	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000072521
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	5.9e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.3e-8	PFAM
Pfam:GAIN	630	856	1.2e-58	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	2.5e-73	PFAM
Pfam:Latrophilin	1207	1274	4e-34	PFAM
Pfam:Latrophilin	1272	1543	5e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117253
AA Change: K222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	5e-73	PFAM
Pfam:Latrophilin	1129	1265	7.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117407
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.4e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	6e-8	PFAM
Pfam:DUF3497	627	857	2.6e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	7.7e-73	PFAM
Pfam:Latrophilin	1197	1321	1.8e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117985
AA Change: K222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.3e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.5e-8	PFAM
Pfam:DUF3497	559	789	1.6e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.7e-72	PFAM
Pfam:Latrophilin	1138	1512	6.8e-178	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118034
AA Change: K222R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.2e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.5e-8	PFAM
Pfam:DUF3497	559	789	1.6e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	6.6e-73	PFAM
Pfam:Latrophilin	1129	1503	6.7e-178	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118078
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	9.7e-27	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.3e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	4.8e-73	PFAM
Pfam:Latrophilin	1129	1201	2.6e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118442
AA Change: K290R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.7e-8	PFAM
Pfam:DUF3497	627	857	1.3e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.4e-72	PFAM
Pfam:Latrophilin	1206	1278	2.8e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119385
AA Change: K290R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.6e-8	PFAM
Pfam:DUF3497	627	857	1.3e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	5.2e-73	PFAM
Pfam:Latrophilin	1197	1269	2.7e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119788
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.7e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.8e-72	PFAM
Pfam:Latrophilin	1206	1279	3.6e-31	PFAM
Pfam:Latrophilin	1273	1550	4.5e-113	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120128
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	9.8e-27	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.4e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.3e-72	PFAM
Pfam:Latrophilin	1138	1210	2.6e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120144
AA Change: K222R

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.3e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	5.1e-73	PFAM
Pfam:Latrophilin	1129	1253	8.4e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120292
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.3e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.3e-72	PFAM
Pfam:Latrophilin	1138	1262	8.5e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120445
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.2e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	2.8e-8	PFAM
Pfam:GAIN	630	856	5.1e-59	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.4e-73	PFAM
Pfam:Latrophilin	1207	1328	8e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120673
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.7e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	3.3e-8	PFAM
Pfam:GAIN	630	856	6.4e-59	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.8e-73	PFAM
Pfam:Latrophilin	1207	1580	1.4e-158	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121641
AA Change: K290R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.8e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	7e-73	PFAM
Pfam:Latrophilin	1197	1571	7.3e-178	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121707
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.6e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	6.8e-73	PFAM
Pfam:Latrophilin	1197	1267	6.4e-30	PFAM
Pfam:Latrophilin	1263	1534	8.7e-113	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122037
AA Change: K222R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: K222R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.2e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.3e-8	PFAM
Pfam:DUF3497	559	789	1.5e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	6.3e-73	PFAM
Pfam:Latrophilin	1129	1199	4.4e-30	PFAM
Pfam:Latrophilin	1194	1460	1.3e-112	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122356
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: K290R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.8e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	7e-8	PFAM
Pfam:DUF3497	627	857	3.1e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	9.3e-73	PFAM
Pfam:Latrophilin	1197	1267	9e-30	PFAM
Pfam:Latrophilin	1262	1528	2.8e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127046

Predicted Effect

probably benign
Transcript: ENSMUST00000132375

SMART Domains

Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136104

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149280

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153264

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Adgrl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Adgrl3	APN	5	81724224	missense	probably damaging	0.99
IGL00596:Adgrl3	APN	5	81646467	missense	probably benign	0.01
IGL00766:Adgrl3	APN	5	81794568	missense	probably damaging	1.00
IGL00787:Adgrl3	APN	5	81693554	missense	probably damaging	1.00
IGL00917:Adgrl3	APN	5	81693574	missense	possibly damaging	0.93
IGL01155:Adgrl3	APN	5	81560893	missense	probably benign	0.39
IGL01348:Adgrl3	APN	5	81726723	missense	probably damaging	1.00
IGL01401:Adgrl3	APN	5	81688669	missense	possibly damaging	0.94
IGL01443:Adgrl3	APN	5	81465287	missense	probably damaging	1.00
IGL01532:Adgrl3	APN	5	81694569	missense	probably damaging	1.00
IGL01779:Adgrl3	APN	5	81387870	missense	probably damaging	1.00
IGL01920:Adgrl3	APN	5	81465296	missense	probably damaging	1.00
IGL02065:Adgrl3	APN	5	81512217	missense	probably damaging	1.00
IGL02365:Adgrl3	APN	5	81512581	missense	probably damaging	1.00
IGL02879:Adgrl3	APN	5	81512119	missense	probably damaging	1.00
R0010:Adgrl3	UTSW	5	81792403	missense	possibly damaging	0.58
R0077:Adgrl3	UTSW	5	81771685	splice site	probably benign
R0103:Adgrl3	UTSW	5	81792347	intron	probably benign
R0138:Adgrl3	UTSW	5	81693607	missense	probably damaging	1.00
R0149:Adgrl3	UTSW	5	81760697	missense	probably damaging	1.00
R0349:Adgrl3	UTSW	5	81771644	missense	probably damaging	1.00
R0361:Adgrl3	UTSW	5	81760697	missense	probably damaging	1.00
R0522:Adgrl3	UTSW	5	81726801	missense	possibly damaging	0.91
R0610:Adgrl3	UTSW	5	81693716	splice site	probably benign
R0658:Adgrl3	UTSW	5	81648713	missense	probably benign	0.18
R0671:Adgrl3	UTSW	5	81560905	missense	probably benign	0.45
R0679:Adgrl3	UTSW	5	81794977	missense	probably damaging	1.00
R1413:Adgrl3	UTSW	5	81693519	missense	probably damaging	1.00
R1444:Adgrl3	UTSW	5	81512353	missense	probably damaging	1.00
R1574:Adgrl3	UTSW	5	81787449	missense	probably damaging	1.00
R1574:Adgrl3	UTSW	5	81787449	missense	probably damaging	1.00
R1738:Adgrl3	UTSW	5	81387979	missense	probably damaging	0.99
R1744:Adgrl3	UTSW	5	81794420	missense	probably damaging	1.00
R1803:Adgrl3	UTSW	5	81771617	nonsense	probably null
R1891:Adgrl3	UTSW	5	81512044	missense	probably damaging	1.00
R1988:Adgrl3	UTSW	5	81688567	missense	probably damaging	1.00
R2126:Adgrl3	UTSW	5	81512536	missense	probably damaging	1.00
R2171:Adgrl3	UTSW	5	81512515	nonsense	probably null
R2891:Adgrl3	UTSW	5	81693519	missense	probably damaging	1.00
R3508:Adgrl3	UTSW	5	81724256	missense	probably damaging	1.00
R3732:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3732:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3733:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3982:Adgrl3	UTSW	5	81694526	missense	possibly damaging	0.95
R4085:Adgrl3	UTSW	5	81512544	missense	probably benign	0.02
R4462:Adgrl3	UTSW	5	81688510	missense	probably damaging	1.00
R4725:Adgrl3	UTSW	5	81766205	missense	possibly damaging	0.67
R4726:Adgrl3	UTSW	5	81646578	missense	possibly damaging	0.61
R4781:Adgrl3	UTSW	5	81760724	missense	probably damaging	1.00
R4837:Adgrl3	UTSW	5	81766234	missense	probably benign	0.07
R4841:Adgrl3	UTSW	5	81794271	missense	possibly damaging	0.53
R4883:Adgrl3	UTSW	5	81689646	missense	probably damaging	1.00
R4921:Adgrl3	UTSW	5	81512110	missense	probably damaging	1.00
R4945:Adgrl3	UTSW	5	81512048	missense	probably damaging	1.00
R5055:Adgrl3	UTSW	5	81646551	missense	possibly damaging	0.48
R5313:Adgrl3	UTSW	5	81726669	missense	probably damaging	1.00
R5385:Adgrl3	UTSW	5	81726801	missense	probably damaging	1.00
R5447:Adgrl3	UTSW	5	81465341	intron	probably benign
R5482:Adgrl3	UTSW	5	81794513	missense	probably damaging	1.00
R5586:Adgrl3	UTSW	5	81724147	missense	probably damaging	0.99
R5637:Adgrl3	UTSW	5	81693544	missense	probably damaging	1.00
R5919:Adgrl3	UTSW	5	81646570	missense	probably benign	0.00
R6090:Adgrl3	UTSW	5	81512326	missense	probably damaging	1.00
R6093:Adgrl3	UTSW	5	81646522	missense	probably benign	0.42
R6107:Adgrl3	UTSW	5	81688563	missense	probably damaging	0.97
R6245:Adgrl3	UTSW	5	81688556	missense	probably benign	0.01
R6426:Adgrl3	UTSW	5	81726870	missense	probably damaging	1.00
R6440:Adgrl3	UTSW	5	81794494	nonsense	probably null
R6516:Adgrl3	UTSW	5	81465272	missense	probably damaging	1.00
R6527:Adgrl3	UTSW	5	81787517	missense	probably damaging	0.99
R6622:Adgrl3	UTSW	5	81794759	missense	probably benign	0.34
R6842:Adgrl3	UTSW	5	81741080	missense	probably damaging	1.00
R6902:Adgrl3	UTSW	5	81689587	missense	probably damaging	1.00
R6921:Adgrl3	UTSW	5	81648713	missense	probably damaging	0.99
R7201:Adgrl3	UTSW	5	81724222	missense	probably damaging	1.00
R7207:Adgrl3	UTSW	5	81310027	start codon destroyed	probably null	0.33
R7215:Adgrl3	UTSW	5	81693550	missense	probably damaging	1.00
R7376:Adgrl3	UTSW	5	81794750	missense	probably damaging	1.00
R7441:Adgrl3	UTSW	5	81724140	missense	possibly damaging	0.70
R7582:Adgrl3	UTSW	5	81693676	missense	probably damaging	0.99
R7682:Adgrl3	UTSW	5	81794560	missense	probably damaging	0.97
Z1088:Adgrl3	UTSW	5	81329882	missense	probably benign	0.33
Z1088:Adgrl3	UTSW	5	81512158	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGACCCTCTACAGGCTTC -3'
(R):5'- TGTAAGGGTTCAACTGGCTAATG -3'

Sequencing Primer
(F):5'- CCTCTACAGGCTTCTGACAAG -3'
(R):5'- GGGTTCAACTGGCTAATGACAATC -3'

Posted On

2014-10-01