Mutagenetix > Incidental Mutation

Incidental Mutation 'R2136:Mical2'

235818

Institutional Source

Beutler Lab

Gene Symbol

Mical2

Ensembl Gene

ENSMUSG00000038244

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 2

Synonyms

5330438E18Rik

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112225856-112355194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112271515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 70 (D70E)

Ref Sequence

ENSEMBL: ENSMUSP00000051163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]

AlphaFold

Q8BML1
Q9D5U9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037991
AA Change: D70E

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: D70E

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1e-8	PFAM
Pfam:FAD_binding_2	88	127	3.2e-6	PFAM
low complexity region	175	188	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
low complexity region	894	925	N/A	INTRINSIC
LIM	979	1033	9.91e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050149
AA Change: D70E

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: D70E

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1.1e-8	PFAM
Pfam:FAD_binding_2	88	127	1.5e-6	PFAM
Pfam:Pyr_redox_2	88	259	1.3e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	9.91e-10	SMART
low complexity region	918	926	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106647

SMART Domains

Protein: ENSMUSP00000102258
Gene: ENSMUSG00000038244

Domain	Start	End	E-Value	Type
Pfam:NAD_binding_7	83	172	5.9e-7	PFAM
Pfam:FAD_binding_3	86	144	5.9e-9	PFAM
Pfam:Pyr_redox	88	126	3.4e-6	PFAM
Pfam:FAD_binding_2	88	127	4.8e-7	PFAM
Pfam:Pyr_redox_2	88	245	2.9e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106648

SMART Domains

Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	9.5e-9	PFAM
Pfam:FAD_binding_2	88	127	1.3e-6	PFAM
Pfam:Pyr_redox_2	88	263	1e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	1.71e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Mical2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Mical2	APN	7	112315072	missense	probably benign	0.00
IGL00934:Mical2	APN	7	112349403	missense	probably damaging	1.00
IGL00941:Mical2	APN	7	112321445	splice site	probably benign
IGL01020:Mical2	APN	7	112315076	splice site	probably benign
IGL01395:Mical2	APN	7	112323585	missense	probably damaging	1.00
IGL01658:Mical2	APN	7	112314998	missense	probably damaging	1.00
IGL02040:Mical2	APN	7	112311406	missense	probably damaging	1.00
IGL02388:Mical2	APN	7	112335413	missense	probably benign
IGL02551:Mical2	APN	7	112323990	missense	probably benign	0.01
IGL02578:Mical2	APN	7	112351373	missense	probably benign	0.05
IGL02751:Mical2	APN	7	112332036	missense	probably benign	0.11
R0101:Mical2	UTSW	7	112336867	missense	possibly damaging	0.86
R0504:Mical2	UTSW	7	112271317	missense	probably benign	0.00
R0594:Mical2	UTSW	7	112318450	missense	probably damaging	0.97
R0609:Mical2	UTSW	7	112321440	splice site	probably null
R1542:Mical2	UTSW	7	112309468	missense	probably damaging	1.00
R1740:Mical2	UTSW	7	112333836	missense	probably benign
R1855:Mical2	UTSW	7	112345282	missense	probably benign	0.21
R2086:Mical2	UTSW	7	112318603	missense	probably benign	0.31
R2418:Mical2	UTSW	7	112320734	critical splice donor site	probably null
R3053:Mical2	UTSW	7	112311423	missense	probably damaging	1.00
R4308:Mical2	UTSW	7	112331992	missense	probably benign	0.27
R4663:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R4868:Mical2	UTSW	7	112318624	missense	probably damaging	1.00
R4902:Mical2	UTSW	7	112336900	missense	probably benign
R5112:Mical2	UTSW	7	112320611	missense	probably damaging	1.00
R5487:Mical2	UTSW	7	112320635	missense	probably damaging	1.00
R5563:Mical2	UTSW	7	112314978	missense	probably damaging	1.00
R5817:Mical2	UTSW	7	112323659	missense	probably benign
R5987:Mical2	UTSW	7	112334948	missense	probably benign	0.00
R6087:Mical2	UTSW	7	112318485	nonsense	probably null
R6209:Mical2	UTSW	7	112324086	splice site	probably null
R6311:Mical2	UTSW	7	112323558	missense	probably damaging	1.00
R6319:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R6578:Mical2	UTSW	7	112311445	missense	probably damaging	1.00
R6782:Mical2	UTSW	7	112346761	missense	probably damaging	1.00
R7061:Mical2	UTSW	7	112346801	missense	probably benign	0.10
R7147:Mical2	UTSW	7	112323603	missense	possibly damaging	0.77
R7260:Mical2	UTSW	7	112319794	missense	probably benign	0.10
R7266:Mical2	UTSW	7	112303756	missense	probably damaging	1.00
R7391:Mical2	UTSW	7	112320609	missense	probably damaging	1.00
R7724:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
R7747:Mical2	UTSW	7	112333839	missense	probably benign	0.02
R7818:Mical2	UTSW	7	112345307	missense	probably damaging	1.00
R8022:Mical2	UTSW	7	112303767	missense	probably damaging	1.00
R8429:Mical2	UTSW	7	112345253	missense	probably benign	0.01
R8505:Mical2	UTSW	7	112319800	missense	probably benign	0.02
R8532:Mical2	UTSW	7	112318544	missense	probably damaging	1.00
R8862:Mical2	UTSW	7	112311367	missense	probably damaging	1.00
R8988:Mical2	UTSW	7	112311454	missense	possibly damaging	0.63
R9123:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9127:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9128:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9129:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9187:Mical2	UTSW	7	112303590	nonsense	probably null
R9310:Mical2	UTSW	7	112351713	missense	probably benign	0.45
R9399:Mical2	UTSW	7	112346875	missense	probably damaging	1.00
R9500:Mical2	UTSW	7	112336847	critical splice acceptor site	probably null
RF008:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
X0062:Mical2	UTSW	7	112346843	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGAACCATGGGAGAGAATG -3'
(R):5'- GGCCATAGCAACAGGATTGG -3'

Sequencing Primer
(F):5'- TGAAGATGAGAAGCAGGCGC -3'
(R):5'- CCATAGCAACAGGATTGGCTTCAAG -3'

Posted On

2014-10-01