Incidental Mutation 'R2418:Mical2'
ID249073
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms5330438E18Rik
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location112225856-112355194 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 112320734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
Predicted Effect probably null
Transcript: ENSMUST00000037991
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050149
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106648
SMART Domains Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 9.5e-9 PFAM
Pfam:FAD_binding_2 88 127 1.3e-6 PFAM
Pfam:Pyr_redox_2 88 263 1e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 1.71e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150428
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R7932:Mical2 UTSW 7 112323461 intron probably null
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGACATTGCAGGGGAG -3'
(R):5'- CAAGTGCTGCCTTTATTGAACC -3'

Sequencing Primer
(F):5'- CATTGCAGGGGAGGACCATAC -3'
(R):5'- CCCTGCATCTTCTGGGGAAAAG -3'
Posted On2014-11-12