Incidental Mutation 'R2439:Micalcl'
ID 249732
Institutional Source Beutler Lab
Gene Symbol Micalcl
Ensembl Gene ENSMUSG00000030771
Gene Name MICAL C-terminal like
Synonyms Ebitein1, 4921517J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2439 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 112368308-112413106 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112394795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 504 (E504G)
Ref Sequence ENSEMBL: ENSMUSP00000102256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033033] [ENSMUST00000051308] [ENSMUST00000106645]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033033
AA Change: E570G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033033
Gene: ENSMUSG00000030771
AA Change: E570G

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 72 100 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 545 562 N/A INTRINSIC
coiled coil region 569 597 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051308
AA Change: E504G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062443
Gene: ENSMUSG00000030771
AA Change: E504G

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106645
AA Change: E504G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102256
Gene: ENSMUSG00000030771
AA Change: E504G

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect not run
Transcript: ENSMUST00000153697
AA Change: E394G
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Micalcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Micalcl APN 7 112382145 missense possibly damaging 0.94
IGL01775:Micalcl APN 7 112382062 missense possibly damaging 0.89
IGL02051:Micalcl APN 7 112381390 missense probably benign 0.30
IGL03114:Micalcl APN 7 112397557 missense probably damaging 1.00
R0091:Micalcl UTSW 7 112381296 missense probably benign 0.05
R0415:Micalcl UTSW 7 112381028 missense probably damaging 1.00
R0962:Micalcl UTSW 7 112380417 missense probably damaging 0.99
R1521:Micalcl UTSW 7 112381610 missense probably damaging 1.00
R1611:Micalcl UTSW 7 112381464 missense probably damaging 0.99
R1815:Micalcl UTSW 7 112412902 missense probably damaging 1.00
R1958:Micalcl UTSW 7 112381104 missense probably benign 0.00
R1962:Micalcl UTSW 7 112412844 missense probably benign 0.14
R3979:Micalcl UTSW 7 112407678 splice site probably null
R4551:Micalcl UTSW 7 112381916 missense possibly damaging 0.87
R4583:Micalcl UTSW 7 112412947 missense probably benign 0.02
R5459:Micalcl UTSW 7 112382237 missense probably benign 0.00
R5763:Micalcl UTSW 7 112374654 critical splice donor site probably null
R6042:Micalcl UTSW 7 112380412 missense probably benign 0.40
R6189:Micalcl UTSW 7 112412880 missense probably damaging 1.00
R6750:Micalcl UTSW 7 112381839 missense probably damaging 0.98
R6798:Micalcl UTSW 7 112376059 utr 3 prime probably benign
R7347:Micalcl UTSW 7 112382151 missense probably benign 0.01
R7783:Micalcl UTSW 7 112412976 missense probably damaging 1.00
R7824:Micalcl UTSW 7 112407637 missense probably damaging 1.00
R7995:Micalcl UTSW 7 112381768 missense probably benign 0.31
R8830:Micalcl UTSW 7 112381196 missense probably benign 0.01
R8906:Micalcl UTSW 7 112381464 missense probably damaging 0.99
R9006:Micalcl UTSW 7 112382116 missense probably benign 0.13
R9140:Micalcl UTSW 7 112407619 missense probably damaging 1.00
R9233:Micalcl UTSW 7 112382192 missense probably benign 0.05
R9304:Micalcl UTSW 7 112381767 missense probably damaging 0.97
R9377:Micalcl UTSW 7 112382039 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGCAACTGTGATGCAAAAG -3'
(R):5'- TCCTGGTTCTCAGAAAAGGGAG -3'

Sequencing Primer
(F):5'- GGTCCTGAGTTCAAATCCCAG -3'
(R):5'- TTCTCAGAAAAGGGAGCAGGCC -3'
Posted On 2014-11-12