Incidental Mutation 'R2504:Ubr3'
ID252070
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission 040412-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2504 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69938198 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 450 (F450I)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: F451I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: F451I

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: F450I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: F450I

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000131553
AA Change: F447I
SMART Domains Protein: ENSMUSP00000121401
Gene: ENSMUSG00000044308
AA Change: F447I

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
low complexity region 65 86 N/A INTRINSIC
Pfam:zf-UBR 117 185 1.2e-21 PFAM
low complexity region 336 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142563
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml5 T C 12: 98,844,105 D864G possibly damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Mast4 A T 13: 102,738,639 I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psd A T 19: 46,324,913 M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rps2 G A 17: 24,720,379 probably benign Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Usp47 T C 7: 112,104,470 probably null Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 intron probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7743:Ubr3 UTSW 2 69944449 missense probably benign 0.28
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACACAAACAGGCTTATGATGTAG -3'
(R):5'- CGGGTATTTGTGAAGGACTAAACTAGG -3'

Sequencing Primer
(F):5'- CAGGTTGCTTTTACAAAAACA -3'
(R):5'- ACAAGTGTGTTTAAAACTTGTTGCAC -3'
Posted On2014-12-04