Incidental Mutation 'R5195:Ubr3'
ID400057
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission 042771-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5195 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69956034 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 831 (A831T)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably benign
Transcript: ENSMUST00000055758
AA Change: A832T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: A832T

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112251
AA Change: A831T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: A831T

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,198,968 Y381C probably damaging Het
Apoo-ps T C 13: 107,414,553 noncoding transcript Het
Arhgef40 T A 14: 51,989,812 S438T possibly damaging Het
Barhl2 A G 5: 106,453,439 L358P possibly damaging Het
Bicra G A 7: 15,979,953 P775S possibly damaging Het
Ccdc78 T A 17: 25,789,988 probably null Het
Ccnb1-ps T A 7: 42,106,098 noncoding transcript Het
Cct6a A T 5: 129,794,655 noncoding transcript Het
Cep120 T A 18: 53,721,698 H455L probably damaging Het
Cobl C T 11: 12,253,565 V964I probably benign Het
Cpt1a A T 19: 3,383,800 I761F possibly damaging Het
Crk T A 11: 75,679,463 Y14N probably damaging Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Fam196a A T 7: 134,884,416 F469I probably damaging Het
Fanca A G 8: 123,303,945 probably benign Het
Gbp4 T A 5: 105,119,532 D507V probably benign Het
Gtf2i A T 5: 134,244,832 L740* probably null Het
Hmgn2 C A 4: 133,967,286 A8S probably benign Het
Hook2 A T 8: 84,994,776 N252I probably damaging Het
Igkv19-93 T A 6: 68,736,526 T39S probably damaging Het
Inpp5j A C 11: 3,499,889 probably null Het
Kbtbd3 G C 9: 4,316,905 E19Q possibly damaging Het
Kcns2 G A 15: 34,839,531 A347T possibly damaging Het
Klhl31 A G 9: 77,650,290 E96G possibly damaging Het
Kptn A G 7: 16,123,103 Y172C probably damaging Het
Krt86 T A 15: 101,476,933 M328K probably benign Het
Lama1 A G 17: 67,764,800 D894G probably benign Het
Lars2 T C 9: 123,453,310 V653A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lhcgr A T 17: 88,742,946 V384D probably damaging Het
Malrd1 C T 2: 16,150,810 T2010M unknown Het
Maml2 T A 9: 13,621,114 N541K probably damaging Het
Med24 T C 11: 98,710,281 K585R possibly damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Mylk T A 16: 34,979,215 F1658L probably damaging Het
Obscn C T 11: 59,060,850 V4392I possibly damaging Het
Olfr744 T C 14: 50,618,786 L188P probably damaging Het
Olfr975 A G 9: 39,950,679 S31P probably benign Het
Pcnx2 A T 8: 125,801,549 F1311I possibly damaging Het
Pcsk1 T C 13: 75,126,855 L521P probably damaging Het
Pde4a A G 9: 21,204,333 T445A possibly damaging Het
Pgam5 A T 5: 110,265,988 L103* probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Polr2a T C 11: 69,744,079 Y618C probably damaging Het
Pramef25 T A 4: 143,950,880 E43V probably damaging Het
Pramel5 T A 4: 144,271,741 M311L probably benign Het
Rbbp8 T C 18: 11,722,151 F478L probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryk T C 9: 102,867,613 V122A probably benign Het
Sik3 G T 9: 46,208,844 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35e4 T A 11: 3,912,872 I106F possibly damaging Het
Slc41a3 T C 6: 90,633,671 S172P probably damaging Het
Snrnp70 T A 7: 45,394,710 K32N probably damaging Het
Spag17 T C 3: 100,101,388 Y1945H probably benign Het
St7 A G 6: 17,743,637 probably benign Het
Stab1 C A 14: 31,140,521 probably benign Het
Taf13 G A 3: 108,581,074 R91Q probably damaging Het
Tmem200a T C 10: 26,078,956 probably benign Het
Tnc A T 4: 63,967,252 L1871Q probably damaging Het
Toe1 T C 4: 116,804,655 H439R probably damaging Het
Trpm1 T C 7: 64,237,693 V893A possibly damaging Het
Wdr89 C T 12: 75,633,288 R64Q probably benign Het
Zbed5 G T 5: 129,902,178 V323F probably benign Het
Zeb2 T C 2: 45,001,635 R287G probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 splice site probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7743:Ubr3 UTSW 2 69944449 missense probably benign 0.28
R7946:Ubr3 UTSW 2 69951395 missense possibly damaging 0.95
R7991:Ubr3 UTSW 2 69952856 missense probably damaging 1.00
R8071:Ubr3 UTSW 2 69988876 missense probably damaging 0.99
R8136:Ubr3 UTSW 2 70021179 missense probably damaging 1.00
R8296:Ubr3 UTSW 2 69954362 missense probably null 1.00
R8313:Ubr3 UTSW 2 69945134 missense probably damaging 0.99
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Z1177:Ubr3 UTSW 2 69897461 missense probably benign 0.17
Z1177:Ubr3 UTSW 2 69897666 missense probably damaging 1.00
Z1177:Ubr3 UTSW 2 69973206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAGTCATTTTCTATTTTGGT -3'
(R):5'- CAGAAGAATGCCAAAACTGGATT -3'

Sequencing Primer
(F):5'- GATGCTGGTGCTAGTCATTA -3'
(R):5'- GCCACAGTTAGCCTATTGAGTAAGC -3'
Posted On2016-07-06