Mutagenetix > Incidental Mutation

Incidental Mutation 'R4960:Ryr1'

382272

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

skrr, calcium release channel isoform 1, Ryr

MMRRC Submission

042557-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4960 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

29003344-29125179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29078783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 2096 (Q2096R)

Ref Sequence

ENSEMBL: ENSMUSP00000137123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032813
AA Change: Q2096R

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: Q2096R

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158594

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179893
AA Change: Q2096R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: Q2096R

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180926

Predicted Effect

probably benign
Transcript: ENSMUST00000214374
AA Change: Q2103R

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	G	T	8: 105,283,211	R369S	probably damaging	Het
Abcc9	A	T	6: 142,620,783		probably null	Het
Adamts20	T	C	15: 94,379,774	H269R	probably benign	Het
Adamtsl1	C	T	4: 86,424,173	Q1642*	probably null	Het
Adamtsl3	A	C	7: 82,566,977	T863P	probably damaging	Het
Adcy3	G	T	12: 4,134,896	V191L	probably benign	Het
Akap9	G	T	5: 3,957,664	R244L	probably benign	Het
Als2cr12	T	A	1: 58,667,806	E234V	probably damaging	Het
Anapc1	C	T	2: 128,684,594	V95M	probably benign	Het
Arhgap17	G	T	7: 123,286,926		probably benign	Het
Arntl	T	A	7: 113,299,435		probably null	Het
Art2b	T	A	7: 101,580,230	Y154F	probably damaging	Het
Atrn	C	T	2: 130,995,047	R1144*	probably null	Het
Atxn3	T	C	12: 101,948,379	S29G	possibly damaging	Het
Batf3	C	T	1: 191,098,510	P18S	probably benign	Het
Bmpr1b	A	T	3: 141,870,785	C96S	probably damaging	Het
Bola1	A	G	3: 96,197,054	S75P	probably benign	Het
Btbd11	A	C	10: 85,651,662	N998T	probably benign	Het
Cela3a	G	A	4: 137,402,648	R221*	probably null	Het
Chat	A	G	14: 32,420,814	V406A	possibly damaging	Het
Chd1	T	A	17: 15,742,231	M750K	probably damaging	Het
Clip1	T	A	5: 123,654,003	K35*	probably null	Het
Cnr2	G	A	4: 135,917,607	G332D	probably benign	Het
Cnrip1	A	G	11: 17,052,228	D20G	probably damaging	Het
Col2a1	T	C	15: 97,976,149	Y1384C	unknown	Het
Col6a3	T	A	1: 90,804,218	I831F	probably damaging	Het
Cp	G	A	3: 19,973,797	V456I	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctbp2	T	C	7: 133,014,238	I323V	probably benign	Het
Ctnna2	C	T	6: 77,653,111	R120H	probably damaging	Het
Cyp2a12	A	G	7: 27,034,150	H318R	probably benign	Het
Cyp2c66	A	T	19: 39,163,322		probably null	Het
Cyp2j8	T	C	4: 96,507,377	T4A	probably benign	Het
Cyp4v3	A	G	8: 45,320,637	V165A	possibly damaging	Het
D5Ertd579e	G	A	5: 36,616,227	R275*	probably null	Het
Deup1	G	T	9: 15,600,968	Q160K	possibly damaging	Het
Dhx36	A	T	3: 62,496,859	I221K	probably damaging	Het
Dnah7b	T	A	1: 46,233,726	M2338K	probably benign	Het
Dync2li1	T	G	17: 84,633,541	L62V	probably benign	Het
Ephb3	A	G	16: 21,220,495	K367R	probably benign	Het
Etv3	A	G	3: 87,528,061	K80E	probably damaging	Het
Gdap1l1	T	C	2: 163,453,859	F346L	probably benign	Het
Gm12794	T	C	4: 101,941,464	Y211H	probably benign	Het
Gm4787	C	T	12: 81,379,316	V23M	probably damaging	Het
Greb1l	T	A	18: 10,547,306	I1508N	probably damaging	Het
Heatr5b	G	A	17: 78,831,584	T43I	probably benign	Het
Hephl1	T	C	9: 15,086,290	Y360C	probably damaging	Het
Itgam	A	C	7: 128,115,840	T865P	possibly damaging	Het
Kcnma1	T	C	14: 24,004,118		probably benign	Het
Kidins220	T	A	12: 24,992,260	C185*	probably null	Het
Klhl35	G	T	7: 99,469,068	G273V	probably damaging	Het
Lama5	A	G	2: 180,208,252		probably null	Het
Lamc3	A	G	2: 31,915,954	Q689R	probably benign	Het
Lnx2	C	T	5: 147,019,040	V649I	probably benign	Het
Lrrc43	A	G	5: 123,499,612	I281V	probably benign	Het
Ly6g6d	C	A	17: 35,071,754	A67S	probably benign	Het
Map1b	A	G	13: 99,432,212	S1334P	probably benign	Het
Marc2	T	A	1: 184,833,919	M186L	probably benign	Het
Mast1	T	A	8: 84,917,871	T810S	probably benign	Het
Mbnl1	A	G	3: 60,595,696	M1V	probably null	Het
Mc5r	T	G	18: 68,338,819	M83R	possibly damaging	Het
Mkln1	T	C	6: 31,459,006	F300S	probably damaging	Het
Mrgpre	A	T	7: 143,781,351	C138*	probably null	Het
Ncbp1	C	T	4: 46,165,273	Q529*	probably null	Het
Nrcam	A	G	12: 44,566,299	D591G	probably benign	Het
Nrxn3	A	T	12: 88,795,201	H6L	possibly damaging	Het
Nsmaf	T	A	4: 6,423,342	D342V	probably damaging	Het
Oip5	TGAGAAA	T	2: 119,617,861		probably benign	Het
Olfr1318	A	G	2: 112,156,352	T134A	probably benign	Het
Olfr202	A	G	16: 59,283,985	S171P	probably benign	Het
Olfr459	C	A	6: 41,772,069	V77F	probably damaging	Het
Olfr667	A	G	7: 104,916,708	I196T	probably benign	Het
Olfr794	A	C	10: 129,571,026	I124L	probably damaging	Het
Omt2a	T	A	9: 78,313,023	E31D	possibly damaging	Het
Phyhipl	A	G	10: 70,568,985	V131A	probably benign	Het
Pik3r5	A	G	11: 68,493,638	M619V	probably benign	Het
Ptprg	A	T	14: 12,237,837	E1431D	probably benign	Het
Rnf20	A	G	4: 49,638,029	T85A	probably damaging	Het
Rtn3	A	T	19: 7,456,521	I683K	probably damaging	Het
Rwdd3	A	G	3: 121,158,821	F174L	probably damaging	Het
Scrn1	T	C	6: 54,534,422	D111G	probably damaging	Het
Sema3e	A	G	5: 14,252,632	R724G	possibly damaging	Het
She	A	G	3: 89,834,237	M232V	possibly damaging	Het
Slc25a54	A	T	3: 109,112,816	N382I	possibly damaging	Het
Slc26a2	T	C	18: 61,198,803	M519V	probably damaging	Het
Slc9a1	T	A	4: 133,370,656	L38H	probably damaging	Het
Slc9a3r1	A	G	11: 115,176,463	D180G	probably benign	Het
Snap47	A	T	11: 59,428,543	D256E	probably damaging	Het
Tacc3	A	G	5: 33,671,982	T610A	probably benign	Het
Tbc1d30	G	A	10: 121,267,216	T637M	probably benign	Het
Tbcd	T	A	11: 121,573,855	M572K	probably benign	Het
Thoc7	A	T	14: 13,953,460	D68E	probably benign	Het
Tmpo	G	A	10: 91,153,309	T250M	probably damaging	Het
Tmtc1	TGTCCGCCAGGCCCTTGCCCCAGAAGTC	TGTC	6: 148,443,947		probably benign	Het
Tnfaip1	A	T	11: 78,527,570	C224S	possibly damaging	Het
Tshz1	T	C	18: 84,014,862	T474A	probably benign	Het
Tspoap1	C	T	11: 87,766,396	Q345*	probably null	Het
Ttc21a	A	G	9: 119,945,001	E258G	possibly damaging	Het
Ttc37	T	A	13: 76,185,156	V1508E	possibly damaging	Het
Ttyh1	T	C	7: 4,128,226	L232P	probably damaging	Het
Usp2	T	A	9: 44,075,813	L136Q	probably damaging	Het
Usp31	T	C	7: 121,648,645	S1192G	probably damaging	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	29102810	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	29124960	splice site	probably null
IGL00427:Ryr1	APN	7	29104737	splice site	probably benign
IGL00559:Ryr1	APN	7	29012242	splice site	probably benign
IGL00803:Ryr1	APN	7	29069645	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	29024229	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	29020195	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	29082543	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	29100202	splice site	probably benign
IGL01385:Ryr1	APN	7	29056985	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	29052337	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	29075227	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	29091076	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	29078597	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	29059810	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	29071658	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	29052015	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	29094047	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	29078696	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	29105066	splice site	probably benign
IGL02472:Ryr1	APN	7	29040844	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	29115599	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	29019763	missense	unknown
IGL02672:Ryr1	APN	7	29004519	unclassified	probably benign
IGL02677:Ryr1	APN	7	29110608	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	29069550	splice site	probably benign
IGL02751:Ryr1	APN	7	29078774	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	29048795	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	29061540	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	29097459	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	29060053	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	29043893	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	29070659	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	29083486	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	29104593	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	29075199	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	29102964	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	29015786	missense	unknown
IGL03146:Ryr1	APN	7	29094032	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	29105040	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	29059855	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	29047542	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0069:Ryr1	UTSW	7	29110505	splice site	probably benign
R0148:Ryr1	UTSW	7	29052035	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	29067588	splice site	probably benign
R0387:Ryr1	UTSW	7	29083367	splice site	probably benign
R0454:Ryr1	UTSW	7	29036075	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	29003793	splice site	probably benign
R0533:Ryr1	UTSW	7	29078780	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	29036076	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	29104795	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	29074609	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	29100189	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	29009697	missense	unknown
R1052:Ryr1	UTSW	7	29096258	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	29086109	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	29116012	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	29070621	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	29083537	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	29092175	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	29062191	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	29095490	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	29094261	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	29101738	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	29036078	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	29116154	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	29078564	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	29047503	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	29101870	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	29067621	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	29079811	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	29009552	missense	unknown
R1861:Ryr1	UTSW	7	29009552	missense	unknown
R1921:Ryr1	UTSW	7	29054944	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	29059472	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	29059631	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	29090150	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	29068442	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	29019741	missense	unknown
R2291:Ryr1	UTSW	7	29098777	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	29075293	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	29103542	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	29009562	missense	unknown
R2571:Ryr1	UTSW	7	29036126	missense	possibly damaging	0.94
R2885:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	29078741	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	29045646	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	29074948	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	29069650	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	29020152	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	29072902	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	29095124	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	29085931	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	29062151	nonsense	probably null
R4257:Ryr1	UTSW	7	29082450	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	29083059	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	29094242	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	29090156	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	29098735	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	29105008	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	29074580	intron	probably benign
R4642:Ryr1	UTSW	7	29086038	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	29059831	missense	probably null	0.99
R4707:Ryr1	UTSW	7	29045662	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	29085833	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	29004821	unclassified	probably benign
R4770:Ryr1	UTSW	7	29109282	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	29095097	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	29019983	missense	unknown
R4933:Ryr1	UTSW	7	29104298	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	29068095	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	29069573	missense	probably damaging	0.98
R5007:Ryr1	UTSW	7	29069115	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	29102809	splice site	probably null
R5013:Ryr1	UTSW	7	29102809	splice site	probably null
R5137:Ryr1	UTSW	7	29101858	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	29067693	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	29036128	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	29115598	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	29068482	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	29117416	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	29109812	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	29071961	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	29024023	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	29069028	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	29086185	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	29015723	missense	unknown
R5575:Ryr1	UTSW	7	29078693	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	29111974	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	29091089	splice site	probably null
R5918:Ryr1	UTSW	7	29009152	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	29104360	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	29046865	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	29116127	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	29071924	missense	probably null	0.98
R5991:Ryr1	UTSW	7	29104610	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	29067637	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	29024241	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	29087438	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	29071973	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	29076239	missense	probably null	1.00
R6147:Ryr1	UTSW	7	29085914	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	29116181	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	29087428	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	29075257	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	29059695	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	29077078	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	29015654	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	29046841	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	29095492	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	29038345	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	29117404	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	29064874	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	29024316	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	29052326	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	29109387	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	29094182	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	29103643	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	29046854	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	29095382	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	29052015	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	29059511	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	29085755	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	29013867	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	29085870	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	29095205	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	29078585	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	29036103	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	29098785	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	29067630	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	29104832	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	29003560	splice site	probably null
R7916:Ryr1	UTSW	7	29090939	nonsense	probably null
R7922:Ryr1	UTSW	7	29097224	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	29096171	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	29003543	missense	unknown
R8052:Ryr1	UTSW	7	29083385	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	29009201	missense	unknown
R8116:Ryr1	UTSW	7	29110883	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	29091032	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	29090225	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	29069121	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	29064639	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	29015717	missense	unknown
R8454:Ryr1	UTSW	7	29015717	missense	unknown
R8487:Ryr1	UTSW	7	29040867	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	29070084	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	29004814	unclassified	probably benign
R8678:Ryr1	UTSW	7	29077064	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	29052328	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	29117377	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	29092268	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	29116132	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	29076872	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	29064859	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	29074666	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	29109213	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	29071915	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	29090215	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	29101933	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	29090997	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	29104564	nonsense	probably null
R9123:Ryr1	UTSW	7	29071804	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	29069858	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	29077046	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	29095099	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	29085762	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	29101852	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	29043888	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	29052388	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	29102829	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	29102964	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	29017962	missense	unknown
R9333:Ryr1	UTSW	7	29074789	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	29068643	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	29073085	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	29078540	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	29024175	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	29015713	missense	unknown
R9664:Ryr1	UTSW	7	29059667	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	29075239	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	29061531	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29020214	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29086035	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	29103498	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	29017985	missense	unknown
Z1177:Ryr1	UTSW	7	29048792	nonsense	probably null
Z1177:Ryr1	UTSW	7	29101922	missense	probably damaging	1.00
Z1186:Ryr1	UTSW	7	29082477	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- TCCAGCAGGCTCATGGTATC -3'
(R):5'- CATGACTATAGGTGGCTGCAG -3'

Sequencing Primer
(F):5'- GCTCATGGTATCCTCCACCGAG -3'
(R):5'- CTGCAGAAGCCAGGGGAG -3'

Posted On

2016-04-27