Incidental Mutation 'R5086:Ago1'
ID387428
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126453604 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 147 (I147V)
Ref Sequence ENSEMBL: ENSMUSP00000134871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: I451V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I451V

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: I147V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: I147V

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 unclassified probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCCTGAACTCATCTGAC -3'
(R):5'- TGTACAGCTCAGGGGCATTG -3'

Sequencing Primer
(F):5'- TGAACTCATCTGACCACATACAG -3'
(R):5'- TCAGGGGCATTGGTTCCCTC -3'
Posted On2016-06-06