Incidental Mutation 'R0456:Sdk2'
ID40039
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0456 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113791466 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2029 (Y2029C)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041627
AA Change: Y2029C

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: Y2029C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156955
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGTGAATGACCCATGAATGAC -3'
(R):5'- TCAGGCTGACCTGGACTCAGTAATG -3'

Sequencing Primer
(F):5'- ggggaggaagaggaggag -3'
(R):5'- GCCCTATATGTTCAAGGACTTCAG -3'
Posted On2013-05-23