Incidental Mutation 'R5429:Tlnrd1'
ID 427069
Institutional Source Beutler Lab
Gene Symbol Tlnrd1
Ensembl Gene ENSMUSG00000070462
Gene Name talin rod domain containing 1
Synonyms Mesdc1
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.832) question?
Stock # R5429 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 83879873-83884305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83882314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 303 (T303N)
Ref Sequence ENSEMBL: ENSMUSP00000091769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094216]
AlphaFold Q9ERE8
Predicted Effect probably damaging
Transcript: ENSMUST00000094216
AA Change: T303N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091769
Gene: ENSMUSG00000070462
AA Change: T303N

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
PDB:2X0C|A 37 320 1e-21 PDB
Blast:MA 100 258 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is regulated by micro RNA MiR-574-3, and is thought to have an oncogenic function in human bladder cancer. A similar gene in mouse is located in a chromosomal region critical for differentiation of mesoderm, which affects embryo patterning and the formation of heart, muscle, blood, skeleton and the urogenital system. The mouse gene is expressed in early development, and in the adult. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Tlnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Tlnrd1 APN 7 83882846 missense probably damaging 1.00
IGL02662:Tlnrd1 APN 7 83882819 missense possibly damaging 0.94
IGL02662:Tlnrd1 APN 7 83882536 missense probably damaging 1.00
Danken UTSW 7 83882630 missense probably damaging 0.97
fallt UTSW 7 83882779 missense probably damaging 1.00
R2096:Tlnrd1 UTSW 7 83882854 missense probably benign 0.05
R2358:Tlnrd1 UTSW 7 83882280 missense probably benign 0.00
R5910:Tlnrd1 UTSW 7 83884485 unclassified probably benign
R6004:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R6931:Tlnrd1 UTSW 7 83882597 missense probably benign 0.15
R7000:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R7481:Tlnrd1 UTSW 7 83882338 missense probably damaging 1.00
R7587:Tlnrd1 UTSW 7 83882947 missense probably damaging 0.98
R7598:Tlnrd1 UTSW 7 83882630 missense probably damaging 0.97
R8047:Tlnrd1 UTSW 7 83882861 missense probably damaging 0.99
R8776:Tlnrd1 UTSW 7 83883108 missense probably benign 0.01
R8776-TAIL:Tlnrd1 UTSW 7 83883108 missense probably benign 0.01
R9366:Tlnrd1 UTSW 7 83882374 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACAGAATTGGAATTCACTGGCG -3'
(R):5'- GTTAGCATGCGTACGCGAAG -3'

Sequencing Primer
(F):5'- ATTCACTGGCGGTAAAGTCC -3'
(R):5'- AAGTGAAGGCGGCACCC -3'
Posted On 2016-09-01