Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Tlnrd1'

427069

Institutional Source

Beutler Lab

Gene Symbol

Tlnrd1

Ensembl Gene

ENSMUSG00000070462

Gene Name

talin rod domain containing 1

Synonyms

Mesdc1

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.859) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83879873-83884305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83882314 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 303 (T303N)

Ref Sequence

ENSEMBL: ENSMUSP00000091769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094216]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094216
AA Change: T303N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091769
Gene: ENSMUSG00000070462
AA Change: T303N

Domain	Start	End	E-Value	Type
low complexity region	9	29	N/A	INTRINSIC
PDB:2X0C\|A	37	320	1e-21	PDB
Blast:MA	100	258	1e-5	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207920

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is regulated by micro RNA MiR-574-3, and is thought to have an oncogenic function in human bladder cancer. A similar gene in mouse is located in a chromosomal region critical for differentiation of mesoderm, which affects embryo patterning and the formation of heart, muscle, blood, skeleton and the urogenital system. The mouse gene is expressed in early development, and in the adult. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Tlnrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Tlnrd1	APN	7	83882846	missense	probably damaging	1.00
IGL02662:Tlnrd1	APN	7	83882819	missense	possibly damaging	0.94
IGL02662:Tlnrd1	APN	7	83882536	missense	probably damaging	1.00
Danken	UTSW	7	83882630	missense	probably damaging	0.97
fallt	UTSW	7	83882779	missense	probably damaging	1.00
R2096:Tlnrd1	UTSW	7	83882854	missense	probably benign	0.05
R2358:Tlnrd1	UTSW	7	83882280	missense	probably benign	0.00
R5910:Tlnrd1	UTSW	7	83884485	unclassified	probably benign
R6004:Tlnrd1	UTSW	7	83882779	missense	probably damaging	1.00
R6931:Tlnrd1	UTSW	7	83882597	missense	probably benign	0.15
R7000:Tlnrd1	UTSW	7	83882779	missense	probably damaging	1.00
R7481:Tlnrd1	UTSW	7	83882338	missense	probably damaging	1.00
R7587:Tlnrd1	UTSW	7	83882947	missense	probably damaging	0.98
R7598:Tlnrd1	UTSW	7	83882630	missense	probably damaging	0.97
R8047:Tlnrd1	UTSW	7	83882861	missense	probably damaging	0.99
R8776:Tlnrd1	UTSW	7	83883108	missense	probably benign	0.01
R8776-TAIL:Tlnrd1	UTSW	7	83883108	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACAGAATTGGAATTCACTGGCG -3'
(R):5'- GTTAGCATGCGTACGCGAAG -3'

Sequencing Primer
(F):5'- ATTCACTGGCGGTAAAGTCC -3'
(R):5'- AAGTGAAGGCGGCACCC -3'

Posted On

2016-09-01