Incidental Mutation 'R5429:Slc9b1'
ID427058
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Namesolute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135348029-135397827 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 135373263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000159658]
Predicted Effect probably null
Transcript: ENSMUST00000078568
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159658
SMART Domains Protein: ENSMUSP00000124452
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 10 83 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160460
SMART Domains Protein: ENSMUSP00000124902
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 149 363 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162767
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135371982 unclassified probably null
IGL02793:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02875:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02977:Slc9b1 APN 3 135397723 missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135394983 splice site probably null
IGL03112:Slc9b1 APN 3 135397672 missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135390508 missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135394909 missense probably damaging 0.99
R0190:Slc9b1 UTSW 3 135357673 missense unknown
R0329:Slc9b1 UTSW 3 135373235 nonsense probably null
R0591:Slc9b1 UTSW 3 135382832 missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135394074 splice site probably benign
R0602:Slc9b1 UTSW 3 135397755 missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135394890 missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135348770 start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135355004 splice site probably null
R1840:Slc9b1 UTSW 3 135357468 missense unknown
R3157:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135382717 missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135357773 intron probably benign
R5154:Slc9b1 UTSW 3 135373179 missense probably damaging 1.00
R5677:Slc9b1 UTSW 3 135357559 missense unknown
R5903:Slc9b1 UTSW 3 135392894 intron probably benign
R5933:Slc9b1 UTSW 3 135393995 missense probably benign 0.30
R6593:Slc9b1 UTSW 3 135357458 start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135371965 missense probably damaging 0.99
R6788:Slc9b1 UTSW 3 135357757 splice site probably null
RF006:Slc9b1 UTSW 3 135357542 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTCTATGCAACCCACC -3'
(R):5'- AGGCACATCTATTTCTATGCACG -3'

Sequencing Primer
(F):5'- TTCTATGCAACCCACCCCATG -3'
(R):5'- TGCACGTTACTAAAGATGACAAC -3'
Posted On2016-09-01