Incidental Mutation 'R4973:Wdfy3'
ID444554
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 042568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4973 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101943119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 532 (D532N)
Ref Sequence ENSEMBL: ENSMUSP00000148521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: D532N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: D532N

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: D532N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: D532N

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174698
AA Change: D532N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: D532N

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: D532N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Ankrd27 A G 7: 35,632,992 D848G probably benign Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atp2c2 A G 8: 119,754,263 T797A probably benign Het
Ccdc121 A T 1: 181,511,264 V41E possibly damaging Het
Ccdc122 A T 14: 77,067,941 I12F possibly damaging Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Cdk5r2 A G 1: 74,855,672 D192G probably damaging Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
Clock A G 5: 76,254,411 V134A possibly damaging Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Csf1r A T 18: 61,129,047 I792F probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D5Ertd579e A G 5: 36,672,905 V25A probably benign Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Ddx5 C A 11: 106,785,007 V286L possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dnhd1 T G 7: 105,713,633 L3801V probably benign Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Ercc6 A G 14: 32,574,902 D1283G probably damaging Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fanca G A 8: 123,308,522 T228M probably damaging Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo16 G T 14: 65,321,297 A302S probably benign Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm6327 T C 16: 12,760,981 noncoding transcript Het
Gnl3 A T 14: 31,013,505 N411K possibly damaging Het
Golga1 A T 2: 39,039,106 D308E probably damaging Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gsap A T 5: 21,254,039 T501S probably benign Het
Helq A G 5: 100,792,871 probably benign Het
Hmcn2 A G 2: 31,344,096 H291R probably benign Het
Htt A T 5: 34,813,023 D505V probably damaging Het
Ildr1 C T 16: 36,708,298 T35I probably benign Het
Iqgap2 A G 13: 95,657,797 probably null Het
Kansl1 C T 11: 104,424,321 R297H probably damaging Het
Kat2b-ps T C 5: 93,391,785 noncoding transcript Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kcnt2 A T 1: 140,609,650 S1116C probably damaging Het
Krt9 C T 11: 100,188,712 G618E unknown Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mdn1 A G 4: 32,734,418 D3275G probably benign Het
Mindy2 A T 9: 70,605,171 V599E possibly damaging Het
Nelfa A G 5: 33,901,818 V231A probably benign Het
Nepro T C 16: 44,734,793 Y411H probably benign Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Nkx1-1 G T 5: 33,431,066 Q293K possibly damaging Het
Nphp3 C T 9: 104,031,999 H803Y probably benign Het
Obscn A G 11: 59,132,466 V695A probably damaging Het
Olfr105-ps G A 17: 37,383,019 A151T probably damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr330 T C 11: 58,529,077 E303G probably benign Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Olfr926 A G 9: 38,878,104 *309W probably null Het
Orai3 T A 7: 127,774,176 L283Q probably damaging Het
Pcdhb13 A T 18: 37,443,184 D205V probably benign Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pgm3 A G 9: 86,562,679 S268P probably benign Het
Piezo2 A T 18: 63,074,680 I1420N probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Psmd13 T A 7: 140,886,853 Y117* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Pum1 T G 4: 130,669,137 S68A probably benign Het
Rnf167 T A 11: 70,649,875 probably benign Het
Rnf213 T C 11: 119,428,157 V1148A possibly damaging Het
Rnf216 T C 5: 143,090,316 E271G probably benign Het
Ros1 A T 10: 52,154,991 I506N probably damaging Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rpl41 A C 10: 128,548,707 probably benign Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Sacs G T 14: 61,213,122 A4206S probably damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc36a3 T C 11: 55,146,804 probably benign Het
Slc39a3 A T 10: 81,030,962 W317R probably damaging Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Snrpd1 T C 18: 10,626,835 V34A probably benign Het
Spire2 T A 8: 123,356,844 I189N probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Taar7b T A 10: 24,000,345 F136Y probably benign Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tcp11l2 A G 10: 84,591,163 I164V probably damaging Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tns4 G T 11: 99,075,213 P448Q probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Usp45 A T 4: 21,815,372 T362S probably damaging Het
Vcan A T 13: 89,688,842 M2861K probably benign Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Zbtb34 T A 2: 33,411,614 Q305L probably benign Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp804b A T 5: 6,771,198 S622T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
R8507:Wdfy3 UTSW 5 101872901 missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101851353 missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 101885198 missense probably benign
R8710:Wdfy3 UTSW 5 101882483 missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 101930085 missense probably benign 0.00
R8749:Wdfy3 UTSW 5 101882580 missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 101917555 missense probably benign 0.11
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AACGGCTTTACCATCCCTGAATG -3'
(R):5'- TGAACATATTTTGGGCAGGTGC -3'

Sequencing Primer
(F):5'- ACCATCCCTGAATGGCTGTAC -3'
(R):5'- GCTGGGCATGTGTTATTTCAAAG -3'
Posted On2016-11-16