Mutagenetix > Incidental Mutation

Incidental Mutation 'R4624:Wdfy3'

346403

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

MMRRC Submission

041889-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R4624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101884083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2277 (R2277Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053177
AA Change: R2291Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: R2291Q

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

not run
Transcript: ENSMUST00000173385
AA Change: R347Q

Predicted Effect

probably benign
Transcript: ENSMUST00000174598
AA Change: R2291Q

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: R2291Q

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212024
AA Change: R2277Q

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.0808

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

93% (85/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730409E04Rik	A	G	4: 126,612,080	T134A	possibly damaging	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adgb	C	A	10: 10,403,004	V267L	probably benign	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd52	A	G	10: 128,389,259	H863R	probably damaging	Het
Ap3b1	A	G	13: 94,483,226	R766G	unknown	Het
Apol7c	A	G	15: 77,526,395	F117S	probably damaging	Het
Bcr	A	T	10: 75,153,920	E716V	probably damaging	Het
Borcs6	T	C	11: 69,060,597	L267P	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Ccdc50	A	G	16: 27,436,601	K223R	probably null	Het
Cd2	T	G	3: 101,287,431	K114Q	probably benign	Het
Cdh19	T	C	1: 110,932,251	K167E	probably benign	Het
Cep131	T	C	11: 120,070,832	E558G	probably damaging	Het
Cmya5	A	T	13: 93,063,551	V3423E	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cntn5	A	T	9: 9,704,804	C663*	probably null	Het
Dnah12	T	C	14: 26,735,758	I893T	possibly damaging	Het
Dopey1	G	A	9: 86,521,525	V129M	probably damaging	Het
Dyx1c1	A	G	9: 72,964,171	I238V	probably benign	Het
Exoc6b	A	G	6: 84,854,809		probably benign	Het
Ext2	A	G	2: 93,703,200	V671A	probably benign	Het
Fcamr	T	G	1: 130,803,262	L28R	probably damaging	Het
Fer1l6	T	C	15: 58,553,705	I144T	probably damaging	Het
Frem1	A	G	4: 82,989,106	L839P	probably damaging	Het
Fscn2	A	T	11: 120,367,343	I364F	probably benign	Het
Gm10291	T	C	3: 78,917,274		noncoding transcript	Het
Gm29125	T	C	1: 80,384,959		noncoding transcript	Het
Grin2b	T	C	6: 135,733,825	M908V	probably damaging	Het
Helz2	T	C	2: 181,239,308	E436G	probably damaging	Het
Hfe	A	T	13: 23,706,078	C149*	probably null	Het
Hs1bp3	T	C	12: 8,336,357	V253A	probably benign	Het
Kat14	A	G	2: 144,404,220		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnh3	T	A	15: 99,226,372	D47E	probably damaging	Het
Kcp	A	G	6: 29,482,814	F1419L	possibly damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Klhl24	A	G	16: 20,120,123	D476G	probably damaging	Het
Krt79	T	A	15: 101,939,806	T137S	possibly damaging	Het
Lilrb4a	A	G	10: 51,491,488	Y42C	probably damaging	Het
Lnx1	C	T	5: 74,660,460		probably benign	Het
Map3k14	A	G	11: 103,231,101	Y497H	probably damaging	Het
Mut	G	A	17: 40,947,055	E371K	probably damaging	Het
Nkx2-6	A	G	14: 69,174,926	Q181R	probably damaging	Het
Notch1	T	C	2: 26,478,081	K631R	possibly damaging	Het
Olfr1436	C	T	19: 12,298,983	V50I	probably benign	Het
Pcdh9	T	A	14: 93,886,409	N775I	probably damaging	Het
Phkb	T	A	8: 85,848,712		probably benign	Het
Pick1	T	A	15: 79,246,466	I250N	probably damaging	Het
Plec	T	C	15: 76,175,135	E3556G	probably damaging	Het
Prex2	C	T	1: 11,289,265	Q1566*	probably null	Het
Ptgr2	T	G	12: 84,308,354	F287L	possibly damaging	Het
Ptprv	T	C	1: 135,124,131		noncoding transcript	Het
Rab5b	G	T	10: 128,683,261	H83Q	probably benign	Het
Ranbp6	A	T	19: 29,810,863	Y696*	probably null	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Rsrc1	T	C	3: 67,349,978	V241A	probably damaging	Het
Ryr2	A	T	13: 12,106,415	I11N	possibly damaging	Het
S100a11	T	C	3: 93,526,014	L55P	probably damaging	Het
Sec13	A	G	6: 113,729,691	S254P	probably benign	Het
Slc25a36	G	A	9: 97,079,125	T147I	probably damaging	Het
Spata31d1c	A	G	13: 65,036,597	E651G	probably benign	Het
Stox2	C	A	8: 47,193,816	R203L	probably damaging	Het
Tbc1d30	A	T	10: 121,296,786	D224E	probably damaging	Het
Tdrd6	A	G	17: 43,625,990	L1389P	probably damaging	Het
Tmprss11b	T	C	5: 86,665,036	S134G	probably benign	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Tnnt1	G	A	7: 4,512,268		probably benign	Het
Tpst2	A	G	5: 112,308,296	M234V	probably damaging	Het
Ttbk2	T	C	2: 120,773,323	D208G	probably benign	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Unc45b	T	A	11: 82,926,009	M425K	probably benign	Het
Uvssa	G	A	5: 33,389,956	E289K	possibly damaging	Het
Vmn2r11	T	A	5: 109,052,235	R451W	probably damaging	Het
Vmn2r45	T	C	7: 8,481,342	Y488C	probably damaging	Het
Vmn2r55	T	A	7: 12,670,700	I259F	possibly damaging	Het
Wdr64	T	G	1: 175,772,263	M111R	probably benign	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0025:Wdfy3	UTSW	5	101845046	missense	probably damaging	0.98
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0513:Wdfy3	UTSW	5	101890789	missense	probably damaging	0.96
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1854:Wdfy3	UTSW	5	101888186	missense	probably benign	0.05
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6259:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9545:Wdfy3	UTSW	5	101953091	missense
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- AGGAAGACACTCTGGAACCTG -3'
(R):5'- GGCTGTGATCTATAACCGTAATGTG -3'

Sequencing Primer
(F):5'- TGGAACCTGCCAGCCCC -3'
(R):5'- CCGTAATGTGAAAACAGTAAAAGAC -3'

Posted On

2015-09-25