Mutagenetix > Incidental Mutation

Incidental Mutation 'R5807:Vmn2r116'

448614

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

043393-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R5807 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23387307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 398 (Y398N)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

probably damaging
Transcript: ENSMUST00000164856
AA Change: Y398N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: Y398N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (65/66)

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,303,492	L943P	probably damaging	Het
Abcg5	C	A	17: 84,672,291	V214F	probably damaging	Het
Ang	T	A	14: 51,101,429		probably benign	Het
Arfgef3	A	G	10: 18,647,798		probably null	Het
Arhgef4	A	G	1: 34,807,615		probably benign	Het
Atp11b	T	C	3: 35,812,279	I409T	probably damaging	Het
Atp5b	G	A	10: 128,088,562		probably benign	Het
Atp9a	G	A	2: 168,653,534	A660V	probably damaging	Het
Avpr1a	A	G	10: 122,449,471	T223A	probably benign	Het
Bmp2k	T	C	5: 97,063,494	M507T	unknown	Het
Cep295	A	G	9: 15,332,532	S287P	probably damaging	Het
Chrna7	T	A	7: 63,148,601	D111V	probably damaging	Het
Cnr2	A	G	4: 135,917,436	D275G	probably benign	Het
Col28a1	T	A	6: 8,158,144	M305L	probably benign	Het
Cpb1	T	A	3: 20,263,742	D206V	probably damaging	Het
Cyp2c50	T	C	19: 40,113,500	L453S	probably damaging	Het
Ddx52	T	G	11: 83,949,682	S284A	probably benign	Het
Efcab1	A	T	16: 14,916,972	I69F	probably benign	Het
Eif2ak4	G	T	2: 118,388,851	R48L	probably benign	Het
Esrrb	A	G	12: 86,514,401	E303G	possibly damaging	Het
Fbxo21	A	G	5: 117,976,868	E23G	probably benign	Het
Fcamr	T	C	1: 130,811,526	S188P	probably damaging	Het
Fer1l6	C	A	15: 58,590,550	S818*	probably null	Het
Fn1	T	C	1: 71,648,059	D213G	probably damaging	Het
Gcg	A	G	2: 62,475,725	I176T	possibly damaging	Het
Glis1	T	A	4: 107,568,082	S109T	probably benign	Het
Gm266	T	C	12: 111,485,739	D11G	probably benign	Het
Gm5070	C	A	3: 95,410,654		noncoding transcript	Het
Gm8444	T	C	15: 81,843,453		probably benign	Het
Gm8989	T	A	7: 106,330,223		noncoding transcript	Het
Golga4	A	G	9: 118,527,130	T117A	probably damaging	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Herc2	T	A	7: 56,230,919	F4766L	probably damaging	Het
Inhbc	C	A	10: 127,357,542	E202*	probably null	Het
Kcnu1	C	T	8: 25,849,714	T20I	possibly damaging	Het
Klhdc3	T	C	17: 46,677,465	D161G	probably damaging	Het
Krt84	T	A	15: 101,530,212	K280M	probably damaging	Het
Krtap9-5	T	A	11: 99,949,069	C199S	unknown	Het
Mrgprb3	A	G	7: 48,643,362	V147A	probably benign	Het
Ndufs6	A	T	13: 73,327,434	F48L	probably damaging	Het
Obscn	T	C	11: 59,079,650	S2586G	probably damaging	Het
Olfr148	A	G	9: 39,614,463	R299G	probably benign	Het
Olfr156	C	A	4: 43,820,912	V150L	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Osbpl6	A	G	2: 76,584,513	D416G	probably damaging	Het
Pdilt	A	G	7: 119,500,543		probably benign	Het
Phf12	C	A	11: 78,022,426	D401E	probably benign	Het
Pla2r1	C	T	2: 60,428,721	V1108M	possibly damaging	Het
Prim2	A	G	1: 33,480,406		probably benign	Het
Ptpn6	T	C	6: 124,724,984	H406R	probably benign	Het
Qpctl	G	T	7: 19,143,207	H329N	probably damaging	Het
Ripk3	T	A	14: 55,785,298	N390Y	probably damaging	Het
Rnase1	A	G	14: 51,145,450	V149A	probably benign	Het
Rtn3	T	A	19: 7,456,827	D581V	probably damaging	Het
Slamf1	A	G	1: 171,775,062	Y119C	probably damaging	Het
Slc25a34	A	G	4: 141,623,662	M12T	probably benign	Het
Tmem38a	A	G	8: 72,580,100	Y141C	probably damaging	Het
Tnr	C	T	1: 159,886,930	T793I	possibly damaging	Het
Tns3	T	C	11: 8,493,211	D384G	probably damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8950:Vmn2r116	UTSW	17	23401493	missense	probably damaging	1.00
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R8977:Vmn2r116	UTSW	17	23386942	missense	possibly damaging	0.56
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGCCTTTGAACAACACCATAG -3'
(R):5'- ACACTTGGTTTGGGCATTTATACTC -3'

Sequencing Primer
(F):5'- GACATTGAACTCTGTCAAATGCC -3'
(R):5'- CATTGTCCTTGGGCAGA -3'

Posted On

2016-12-15