Mutagenetix > Incidental Mutation

Incidental Mutation 'R5937:Cntn6'

462320

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

043242-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R5937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 104833103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 582 (T582K)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: T582K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: T582K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070
AA Change: T510K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: T510K

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: T582K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: T582K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	A	T	15: 60,919,646	W314R	probably benign	Het
Adgrv1	A	T	13: 81,107,075	V6143E	probably damaging	Het
Agap3	C	T	5: 24,477,817	T261I	probably damaging	Het
Ano6	T	C	15: 95,913,957	I241T	probably damaging	Het
Arhgef28	T	C	13: 97,939,543	T1328A	probably benign	Het
Capn10	C	T	1: 92,939,383	R112W	probably damaging	Het
Car5a	A	T	8: 121,939,821	W46R	probably damaging	Het
Ctsh	T	C	9: 90,061,456	V60A	probably benign	Het
Ctsll3	A	G	13: 60,799,596	F259L	probably damaging	Het
Fam228a	T	C	12: 4,737,725	E16G	probably damaging	Het
G3bp2	A	G	5: 92,055,397	I388T	probably damaging	Het
Galnt5	A	T	2: 58,038,937	K926N	probably benign	Het
Gm10097	G	A	10: 5,069,485		probably benign	Het
Gm9978	T	A	10: 78,486,841		noncoding transcript	Het
Gria1	A	G	11: 57,189,733	T112A	probably benign	Het
Hnrnpk	A	C	13: 58,395,202	V134G	probably damaging	Het
Insr	A	G	8: 3,174,808	V220A	probably benign	Het
Lhx4	A	G	1: 155,710,277	I96T	probably damaging	Het
Lrp1	T	C	10: 127,583,876	T955A	possibly damaging	Het
Lrtm1	T	C	14: 29,021,830	V85A	possibly damaging	Het
Man2a2	T	C	7: 80,363,503	Y514C	probably damaging	Het
Npas1	T	A	7: 16,463,262	D226V	probably benign	Het
Nrcam	G	A	12: 44,572,291	V858I	probably benign	Het
Olfr1462	T	A	19: 13,191,311	S215T	probably damaging	Het
Olfr293	G	T	7: 86,664,476	L271F	probably benign	Het
Pde6b	G	T	5: 108,424,327	A478S	probably benign	Het
Pex1	T	A	5: 3,624,487	N789K	possibly damaging	Het
Plekha6	A	G	1: 133,260,101	D120G	possibly damaging	Het
Pomgnt1	A	G	4: 116,153,913	T220A	probably benign	Het
Sdr39u1	A	T	14: 55,897,907	I193K	probably damaging	Het
Sec61a2	C	A	2: 5,886,557	M54I	probably benign	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sra1	C	T	18: 36,671,599		probably null	Het
St5	A	T	7: 109,557,271	C91S	possibly damaging	Het
Taf5	C	T	19: 47,081,895	S640L	probably damaging	Het
Tas2r140	T	A	6: 133,055,273	H174L	probably benign	Het
Tmem63a	T	A	1: 180,961,151	V351D	probably damaging	Het
Ttll7	C	T	3: 146,944,092	Q626*	probably null	Het
Ubn2	T	A	6: 38,463,982	V263E	possibly damaging	Het
Vmn2r106	C	T	17: 20,285,405	W9*	probably null	Het
Xrcc3	C	G	12: 111,807,972	C141S	probably null	Het
Zfp516	T	A	18: 82,956,833	D385E	probably damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGTTTTCTGGATGCAATTAGAG -3'
(R):5'- CTGGAACTATTTGCTAAGCACAATC -3'

Sequencing Primer
(F):5'- TTCTGGATGCAATTAGAGTAAAAGG -3'
(R):5'- ATTTGCTAAGCACAATCTTTCTTTC -3'

Posted On

2017-02-28