Mutagenetix > Incidental Mutation

Incidental Mutation 'R0632:Rasgrf2'

59737

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

038821-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R0632 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91972274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 787 (S787P)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably benign
Transcript: ENSMUST00000099326
AA Change: S787P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: S787P

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142378
AA Change: S187P

SMART Domains

Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: S187P

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
Blast:RasGEFN	187	249	8e-29	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: S186P

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: S186P

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Meta Mutation Damage Score

0.0724

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Ap4e1	C	A	2: 127,049,280	Y522*	probably null	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mcub	T	C	3: 129,918,726	M167V	probably benign	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msh4	A	G	3: 153,896,895	I232T	probably damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Myo7a	A	T	7: 98,112,150		probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Ptprc	C	T	1: 138,073,610	V965I	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tacc2	A	T	7: 130,625,595	K1356*	probably null	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACACTGATCTAGAAGCACAGGATGAC -3'
(R):5'- GCAGCAGATCCACTGCACACTTTATG -3'

Sequencing Primer
(F):5'- CTAGAAGCACAGGATGACTTTTC -3'
(R):5'- GATCAGTGGATCACTAGCCTG -3'

Posted On

2013-07-11