Incidental Mutation 'R6223:Pcolce'
ID 504136
Institutional Source Beutler Lab
Gene Symbol Pcolce
Ensembl Gene ENSMUSG00000029718
Gene Name procollagen C-endopeptidase enhancer protein
Synonyms Astt-2, Astt2
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137603369-137609666 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137603561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 424 (M424T)
Ref Sequence ENSEMBL: ENSMUSP00000031731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031731] [ENSMUST00000037620] [ENSMUST00000054564] [ENSMUST00000111007] [ENSMUST00000124693] [ENSMUST00000197912] [ENSMUST00000142675] [ENSMUST00000155251] [ENSMUST00000133705] [ENSMUST00000154708]
AlphaFold Q61398
Predicted Effect probably damaging
Transcript: ENSMUST00000031731
AA Change: M424T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031731
Gene: ENSMUSG00000029718
AA Change: M424T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 158 272 3e-46 SMART
low complexity region 299 314 N/A INTRINSIC
low complexity region 323 338 N/A INTRINSIC
C345C 352 458 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037620
SMART Domains Protein: ENSMUSP00000040828
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 133 1.2e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000054564
AA Change: M449T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057002
Gene: ENSMUSG00000029718
AA Change: M449T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 183 297 3e-46 SMART
low complexity region 324 339 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
C345C 377 483 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111007
SMART Domains Protein: ENSMUSP00000106636
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 3.5e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128755
Predicted Effect unknown
Transcript: ENSMUST00000197912
AA Change: M202T
SMART Domains Protein: ENSMUSP00000142608
Gene: ENSMUSG00000029718
AA Change: M202T

DomainStartEndE-ValueType
CUB 1 107 2.2e-36 SMART
C345C 130 236 1.3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198801
Predicted Effect probably benign
Transcript: ENSMUST00000142675
SMART Domains Protein: ENSMUSP00000115654
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 18 130 3.79e-43 SMART
CUB 140 214 2.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136649
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133705
SMART Domains Protein: ENSMUSP00000122462
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
SCOP:d1grwa_ 34 74 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154708
SMART Domains Protein: ENSMUSP00000116851
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 2.3e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in thickened cortical and trabecular bone and abnormal collagen fibrils in both mineralized and nonmineralized tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Ap3b2 G A 7: 81,123,210 (GRCm39) R435* probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pi4ka A T 16: 17,175,435 (GRCm39) Y464* probably null Het
Pik3c2b T A 1: 132,998,095 (GRCm39) L324M probably damaging Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Sirpb1a A G 3: 15,444,086 (GRCm39) V388A probably benign Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tdrd1 T C 19: 56,854,282 (GRCm39) V1076A probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Pcolce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Pcolce APN 5 137,605,738 (GRCm39) missense probably damaging 0.98
IGL01566:Pcolce APN 5 137,603,422 (GRCm39) utr 3 prime probably benign
R0157:Pcolce UTSW 5 137,608,741 (GRCm39) splice site probably null
R1585:Pcolce UTSW 5 137,608,769 (GRCm39) nonsense probably null
R2307:Pcolce UTSW 5 137,607,356 (GRCm39) missense probably damaging 0.99
R2507:Pcolce UTSW 5 137,605,313 (GRCm39) missense possibly damaging 0.93
R3700:Pcolce UTSW 5 137,607,309 (GRCm39) missense probably damaging 0.98
R4011:Pcolce UTSW 5 137,604,036 (GRCm39) missense probably benign 0.00
R4223:Pcolce UTSW 5 137,603,389 (GRCm39) utr 3 prime probably benign
R4983:Pcolce UTSW 5 137,603,936 (GRCm39) intron probably benign
R5141:Pcolce UTSW 5 137,604,012 (GRCm39) missense probably benign 0.05
R5626:Pcolce UTSW 5 137,608,661 (GRCm39) missense probably damaging 0.99
R6241:Pcolce UTSW 5 137,603,496 (GRCm39) missense probably benign 0.00
R6643:Pcolce UTSW 5 137,607,165 (GRCm39) missense probably damaging 0.97
R6938:Pcolce UTSW 5 137,603,878 (GRCm39) missense probably benign 0.11
R7583:Pcolce UTSW 5 137,605,707 (GRCm39) missense probably benign 0.01
R7596:Pcolce UTSW 5 137,605,087 (GRCm39) critical splice donor site probably null
R7703:Pcolce UTSW 5 137,603,474 (GRCm39) missense probably benign 0.00
R7991:Pcolce UTSW 5 137,607,390 (GRCm39) missense probably benign 0.04
R8012:Pcolce UTSW 5 137,603,457 (GRCm39) missense probably benign 0.02
R8734:Pcolce UTSW 5 137,609,550 (GRCm39) missense probably damaging 0.98
R9131:Pcolce UTSW 5 137,603,770 (GRCm39) missense probably benign 0.01
R9272:Pcolce UTSW 5 137,606,333 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACGATCCCTTCCTGAGTCAAG -3'
(R):5'- AGTTGTATGTGCCCTGCAG -3'

Sequencing Primer
(F):5'- GAAACATTTATTTGGATGAGCTCTG -3'
(R):5'- GTTGAGCACACTGAAGGT -3'
Posted On 2018-02-28