Incidental Mutation 'R6223:Pcolce'
ID504136
Institutional Source Beutler Lab
Gene Symbol Pcolce
Ensembl Gene ENSMUSG00000029718
Gene Nameprocollagen C-endopeptidase enhancer protein
SynonymsAstt-2, Astt2
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137605103-137613784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137605299 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 424 (M424T)
Ref Sequence ENSEMBL: ENSMUSP00000031731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031731] [ENSMUST00000037620] [ENSMUST00000054564] [ENSMUST00000111007] [ENSMUST00000124693] [ENSMUST00000133705] [ENSMUST00000142675] [ENSMUST00000197912] [ENSMUST00000155251] [ENSMUST00000154708]
Predicted Effect probably damaging
Transcript: ENSMUST00000031731
AA Change: M424T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031731
Gene: ENSMUSG00000029718
AA Change: M424T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 158 272 3e-46 SMART
low complexity region 299 314 N/A INTRINSIC
low complexity region 323 338 N/A INTRINSIC
C345C 352 458 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037620
SMART Domains Protein: ENSMUSP00000040828
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 133 1.2e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000054564
AA Change: M449T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057002
Gene: ENSMUSG00000029718
AA Change: M449T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 183 297 3e-46 SMART
low complexity region 324 339 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
C345C 377 483 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111007
SMART Domains Protein: ENSMUSP00000106636
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 3.5e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131703
Predicted Effect probably benign
Transcript: ENSMUST00000133705
SMART Domains Protein: ENSMUSP00000122462
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
SCOP:d1grwa_ 34 74 7e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137210
Predicted Effect probably benign
Transcript: ENSMUST00000142675
SMART Domains Protein: ENSMUSP00000115654
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 18 130 3.79e-43 SMART
CUB 140 214 2.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146589
Predicted Effect unknown
Transcript: ENSMUST00000197912
AA Change: M202T
SMART Domains Protein: ENSMUSP00000142608
Gene: ENSMUSG00000029718
AA Change: M202T

DomainStartEndE-ValueType
CUB 1 107 2.2e-36 SMART
C345C 130 236 1.3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148662
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154708
SMART Domains Protein: ENSMUSP00000116851
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 2.3e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in thickened cortical and trabecular bone and abnormal collagen fibrils in both mineralized and nonmineralized tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Pcolce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Pcolce APN 5 137607476 missense probably damaging 0.98
IGL01566:Pcolce APN 5 137605160 utr 3 prime probably benign
R0157:Pcolce UTSW 5 137610479 splice site probably null
R1585:Pcolce UTSW 5 137610507 nonsense probably null
R2307:Pcolce UTSW 5 137609094 missense probably damaging 0.99
R2507:Pcolce UTSW 5 137607051 missense possibly damaging 0.93
R3700:Pcolce UTSW 5 137609047 missense probably damaging 0.98
R4011:Pcolce UTSW 5 137605774 missense probably benign 0.00
R4223:Pcolce UTSW 5 137605127 utr 3 prime probably benign
R4983:Pcolce UTSW 5 137605674 intron probably benign
R5141:Pcolce UTSW 5 137605750 missense probably benign 0.05
R5626:Pcolce UTSW 5 137610399 missense probably damaging 0.99
R6241:Pcolce UTSW 5 137605234 missense probably benign 0.00
R6643:Pcolce UTSW 5 137608903 missense probably damaging 0.97
R6938:Pcolce UTSW 5 137605616 missense probably benign 0.11
R7583:Pcolce UTSW 5 137607445 missense probably benign 0.01
R7596:Pcolce UTSW 5 137606825 critical splice donor site probably null
R7703:Pcolce UTSW 5 137605212 missense probably benign 0.00
R7991:Pcolce UTSW 5 137609128 missense probably benign 0.04
R8012:Pcolce UTSW 5 137605195 missense probably benign 0.02
R8734:Pcolce UTSW 5 137611288 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGATCCCTTCCTGAGTCAAG -3'
(R):5'- AGTTGTATGTGCCCTGCAG -3'

Sequencing Primer
(F):5'- GAAACATTTATTTGGATGAGCTCTG -3'
(R):5'- GTTGAGCACACTGAAGGT -3'
Posted On2018-02-28