Incidental Mutation 'R6223:Ncan'
ID504148
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Nameneurocan
SynonymsCspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70093085-70120873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70109954 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 551 (D551E)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: D551E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: D551E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGTCACATGCATTTACACC -3'
(R):5'- ATGGTCGACACTTCCAGCAG -3'

Sequencing Primer
(F):5'- CACATTGCACTTAGTCACATGG -3'
(R):5'- ACACTTCCAGCAGCAGGG -3'
Posted On2018-02-28