Mutagenetix > Incidental Mutation

Incidental Mutation 'R6223:Prx'

504142

Institutional Source

Beutler Lab

Gene Symbol

Prx

Ensembl Gene

ENSMUSG00000053198

Gene Name

periaxin

Synonyms

L-Periaxin

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27499324-27520214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 27516836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 393 (M393R)

Ref Sequence

ENSEMBL: ENSMUSP00000096241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108355] [ENSMUST00000125990]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065487
AA Change: M393R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: M393R

Domain	Start	End	E-Value	Type
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	9.05e-5	PROSPERO
internal_repeat_2	317	428	7.28e-6	PROSPERO
internal_repeat_1	321	508	8.09e-9	PROSPERO
internal_repeat_1	503	779	8.09e-9	PROSPERO
internal_repeat_2	840	974	7.28e-6	PROSPERO
internal_repeat_3	1176	1268	9.05e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098644
AA Change: M393R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: M393R

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	5.13e-5	PROSPERO
internal_repeat_2	317	428	3.79e-6	PROSPERO
internal_repeat_1	321	508	3.34e-9	PROSPERO
internal_repeat_1	503	779	3.34e-9	PROSPERO
internal_repeat_2	840	974	3.79e-6	PROSPERO
internal_repeat_3	1176	1268	5.13e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108355

SMART Domains

Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125990
AA Change: M254R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Prx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Prx	APN	7	27519419	missense	probably benign	0.12
IGL01702:Prx	APN	7	27519787	missense	probably benign	0.00
IGL02012:Prx	APN	7	27517901	missense	probably damaging	1.00
IGL02214:Prx	APN	7	27518912	missense	probably damaging	1.00
IGL02498:Prx	APN	7	27518072	missense	probably damaging	1.00
IGL03029:Prx	APN	7	27508061	nonsense	probably null
R0522:Prx	UTSW	7	27518195	missense	probably damaging	0.99
R0655:Prx	UTSW	7	27517421	missense	probably damaging	1.00
R0904:Prx	UTSW	7	27518294	missense	probably damaging	1.00
R1161:Prx	UTSW	7	27519677	missense	probably damaging	1.00
R1170:Prx	UTSW	7	27518007	nonsense	probably null
R1270:Prx	UTSW	7	27518930	missense	probably damaging	0.96
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1536:Prx	UTSW	7	27517258	missense	probably damaging	0.99
R1721:Prx	UTSW	7	27517523	missense	probably benign	0.19
R1815:Prx	UTSW	7	27516665	missense	probably damaging	1.00
R1848:Prx	UTSW	7	27518888	missense	possibly damaging	0.70
R1894:Prx	UTSW	7	27519110	missense	possibly damaging	0.68
R2179:Prx	UTSW	7	27517985	missense	probably benign
R2207:Prx	UTSW	7	27516788	missense	probably damaging	1.00
R2312:Prx	UTSW	7	27516626	missense	possibly damaging	0.87
R2356:Prx	UTSW	7	27507859	start gained	probably benign
R2519:Prx	UTSW	7	27518243	missense	probably benign	0.43
R2912:Prx	UTSW	7	27516229	missense	probably damaging	1.00
R4717:Prx	UTSW	7	27516727	missense	probably benign	0.07
R4868:Prx	UTSW	7	27517579	missense	probably benign	0.01
R5153:Prx	UTSW	7	27518476	missense	probably damaging	1.00
R5418:Prx	UTSW	7	27517274	missense	probably damaging	0.99
R5653:Prx	UTSW	7	27517604	missense	probably damaging	1.00
R5895:Prx	UTSW	7	27515284	missense	probably damaging	1.00
R6022:Prx	UTSW	7	27517573	missense	probably damaging	1.00
R6112:Prx	UTSW	7	27516548	missense	probably damaging	1.00
R6560:Prx	UTSW	7	27515321	missense	probably damaging	1.00
R6888:Prx	UTSW	7	27519634	missense	possibly damaging	0.73
R7530:Prx	UTSW	7	27507972	missense	probably damaging	1.00
R7854:Prx	UTSW	7	27516641	missense	probably damaging	1.00
R8258:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8259:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8831:Prx	UTSW	7	27518113	missense	probably damaging	0.99
R9335:Prx	UTSW	7	27518071	missense	probably damaging	1.00
R9602:Prx	UTSW	7	27519020	missense	possibly damaging	0.93
R9717:Prx	UTSW	7	27517986	missense	probably benign	0.32
RF009:Prx	UTSW	7	27518960	missense	probably damaging	1.00
X0028:Prx	UTSW	7	27517733	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAGTGGTAAAAGTCCCTACC -3'
(R):5'- TTGACCTCAGGAACCTTAGGG -3'

Sequencing Primer
(F):5'- GTAAAAGTCCCTACCCTGGATGTG -3'
(R):5'- CTCAGGAACCTTAGGGAGCTTTAC -3'

Posted On

2018-02-28