Incidental Mutation 'R6698:Cdk17'
ID528655
Institutional Source Beutler Lab
Gene Symbol Cdk17
Ensembl Gene ENSMUSG00000020015
Gene Namecyclin-dependent kinase 17
SynonymsPctk2, 6430598J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6698 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93160875-93267071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93228678 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 270 (Y270H)
Ref Sequence ENSEMBL: ENSMUSP00000150873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069965] [ENSMUST00000215286]
Predicted Effect probably damaging
Transcript: ENSMUST00000069965
AA Change: Y303H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070355
Gene: ENSMUSG00000020015
AA Change: Y303H

DomainStartEndE-ValueType
S_TKc 192 473 4.67e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215286
AA Change: Y270H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215495
Meta Mutation Damage Score 0.7900 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Cdk17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cdk17 APN 10 93226771 missense probably damaging 1.00
IGL00781:Cdk17 APN 10 93232416 missense probably damaging 1.00
IGL01622:Cdk17 APN 10 93238962 unclassified probably benign
IGL01623:Cdk17 APN 10 93238962 unclassified probably benign
IGL01732:Cdk17 APN 10 93218045 missense probably benign 0.01
IGL01768:Cdk17 APN 10 93208261 missense probably damaging 0.99
IGL02942:Cdk17 APN 10 93238968 missense probably benign
IGL03308:Cdk17 APN 10 93221644 critical splice donor site probably null
R0039:Cdk17 UTSW 10 93226778 splice site probably benign
R0398:Cdk17 UTSW 10 93237840 missense probably benign 0.01
R0432:Cdk17 UTSW 10 93237790 unclassified probably benign
R0609:Cdk17 UTSW 10 93216472 missense probably benign
R0781:Cdk17 UTSW 10 93239033 nonsense probably null
R1110:Cdk17 UTSW 10 93239033 nonsense probably null
R1604:Cdk17 UTSW 10 93232498 missense probably damaging 1.00
R1674:Cdk17 UTSW 10 93221630 missense probably benign 0.21
R1758:Cdk17 UTSW 10 93208250 missense probably damaging 1.00
R1797:Cdk17 UTSW 10 93208252 missense possibly damaging 0.76
R1864:Cdk17 UTSW 10 93226105 missense probably damaging 1.00
R1924:Cdk17 UTSW 10 93226117 missense probably damaging 1.00
R1929:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R2143:Cdk17 UTSW 10 93218019 missense probably damaging 1.00
R2207:Cdk17 UTSW 10 93228762 missense probably damaging 1.00
R2261:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R2262:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R3737:Cdk17 UTSW 10 93221644 critical splice donor site probably null
R3883:Cdk17 UTSW 10 93212077 critical splice donor site probably null
R4436:Cdk17 UTSW 10 93211896 splice site probably null
R5372:Cdk17 UTSW 10 93226039 missense probably benign 0.03
R5444:Cdk17 UTSW 10 93217961 splice site probably null
R5488:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5489:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5815:Cdk17 UTSW 10 93228697 missense probably damaging 1.00
R6164:Cdk17 UTSW 10 93235469 missense probably benign 0.26
R6209:Cdk17 UTSW 10 93208231 missense probably benign 0.05
R6384:Cdk17 UTSW 10 93211965 missense probably damaging 0.99
R6627:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R7164:Cdk17 UTSW 10 93232481 missense probably benign 0.07
R8096:Cdk17 UTSW 10 93216367 missense probably damaging 0.98
R8118:Cdk17 UTSW 10 93216390 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCCAACCAATGAACTGCTGTTATTC -3'
(R):5'- TGACGACACTCTGTGACAAC -3'

Sequencing Primer
(F):5'- CCTGGTTCTCATTGGGTTAAAAAC -3'
(R):5'- ACACTCTGTGACAACGGTGGTC -3'
Posted On2018-07-24