Mutagenetix > Incidental Mutation

Incidental Mutation 'R7027:Usp24'

546026

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106362244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 546 (S546P)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably benign
Transcript: ENSMUST00000094933
AA Change: S545P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: S545P

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165709
AA Change: S546P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: S546P

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Meta Mutation Damage Score

0.0991

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	G	2: 85,485,527	Y440H	probably damaging	Het
Acoxl	A	T	2: 128,010,083	M102L	probably benign	Het
Adcy10	A	G	1: 165,518,246	E288G	probably damaging	Het
Agap1	A	G	1: 89,888,722	H748R	probably benign	Het
Ahsg	T	C	16: 22,892,257	L48P	probably damaging	Het
Ankrd27	A	G	7: 35,612,526	T394A	probably benign	Het
Apc	T	G	18: 34,312,076	V657G	probably damaging	Het
Arl2	T	C	19: 6,141,089	T5A	probably benign	Het
B020011L13Rik	A	G	1: 117,801,450	Y229C	probably benign	Het
B3gnt5	T	A	16: 19,769,990	S320T	probably damaging	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
BC107364	T	G	3: 96,440,741	R77S	unknown	Het
Brox	G	A	1: 183,284,186	P206L	possibly damaging	Het
Ccrl2	T	C	9: 111,055,885	K182E	probably benign	Het
Cd19	A	G	7: 126,410,499	V465A	possibly damaging	Het
Chrdl2	A	T	7: 100,022,033	Q126H	probably damaging	Het
Cnbd1	G	A	4: 18,862,063	P376S	probably benign	Het
Cobll1	A	G	2: 65,089,503	S1194P	probably benign	Het
Col6a4	T	C	9: 106,067,014	Y1087C	probably damaging	Het
Col9a2	G	A	4: 121,044,019		probably null	Het
Cyp4v3	A	G	8: 45,310,252	S341P	possibly damaging	Het
Dnah7a	T	A	1: 53,631,506	Y529F	probably benign	Het
Eif3b	C	T	5: 140,425,288	R165W	probably damaging	Het
Erlec1	C	A	11: 30,950,790	C126F	probably damaging	Het
Fat2	T	C	11: 55,269,433	T3285A	probably benign	Het
Fat2	G	A	11: 55,281,851	R2679*	probably null	Het
Fbxo31	T	C	8: 121,578,485	T91A	probably damaging	Het
Fkbp5	A	G	17: 28,412,063	Y243H	probably damaging	Het
Flcn	C	T	11: 59,795,806	V374M	probably damaging	Het
Fndc5	A	G	4: 129,139,523	M128V	probably benign	Het
Gal3st1	A	G	11: 3,999,002	D403G	probably damaging	Het
Garem1	T	C	18: 21,129,994	N588D	probably benign	Het
Gas1	T	C	13: 60,176,233	T196A	probably damaging	Het
Gcn1l1	T	C	5: 115,616,546		probably null	Het
Gprc5d	T	G	6: 135,116,648	Q87P	probably damaging	Het
Grm1	A	G	10: 10,719,595	L763P	probably damaging	Het
Hivep2	G	T	10: 14,149,577	K2378N	probably damaging	Het
Hivep2	G	T	10: 14,149,578	D2379Y	probably damaging	Het
Itgad	A	G	7: 128,182,989	Y199C	probably damaging	Het
Itm2c	A	G	1: 85,906,485	I174V	probably benign	Het
Khdrbs2	A	G	1: 32,414,916	S128G	probably benign	Het
Map3k9	T	C	12: 81,730,624	T528A	probably benign	Het
Mmp11	G	A	10: 75,932,396		probably benign	Het
Mycbpap	T	A	11: 94,514,614	I30F	probably damaging	Het
Nfya	T	C	17: 48,389,312	T335A	probably benign	Het
Npat	T	A	9: 53,569,916	S1008T	possibly damaging	Het
Olfr1145	A	G	2: 87,810,716	T299A	possibly damaging	Het
Olfr121	G	A	17: 37,752,409	C185Y	probably damaging	Het
Olfr494	A	T	7: 108,368,350	M287L	probably damaging	Het
Olfr818	C	T	10: 129,945,172	A297T	possibly damaging	Het
Osbpl10	T	C	9: 115,223,698	V613A	probably damaging	Het
Pcdhga8	T	C	18: 37,727,111	W407R	probably benign	Het
Pcdhgb4	A	G	18: 37,721,362	D270G	probably damaging	Het
Pde2a	A	C	7: 101,511,597	E918D	probably damaging	Het
Plekhg5	A	G	4: 152,113,974	D873G	probably benign	Het
Pno1	A	T	11: 17,208,880	S173T	possibly damaging	Het
Ppfia3	A	G	7: 45,354,736	I494T	possibly damaging	Het
Prkrip1	C	A	5: 136,181,413		probably benign	Het
Psma5	A	G	3: 108,265,168	I67V	probably benign	Het
Reep6	G	A	10: 80,333,965		probably null	Het
Rtl1	CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC	CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC	12: 109,591,414		probably benign	Het
Scyl2	C	G	10: 89,645,461		probably null	Het
Sdk1	T	A	5: 142,096,726		probably null	Het
Senp5	C	A	16: 31,989,295	K380N	probably benign	Het
Slc22a14	A	T	9: 119,231,215		probably null	Het
Slc26a5	T	A	5: 21,816,974	T485S	possibly damaging	Het
Slc44a5	T	C	3: 154,253,719	I349T	probably benign	Het
Smarca5	T	C	8: 80,736,726	E71G	probably benign	Het
Smok2a	A	T	17: 13,225,779	H81L	probably damaging	Het
Snrnp200	A	G	2: 127,217,272	D388G	probably benign	Het
Tank	T	C	2: 61,653,422	V404A	probably benign	Het
Tek	A	G	4: 94,865,510	D1063G	probably damaging	Het
Tfap2a	C	T	13: 40,733,674	C16Y	probably benign	Het
Tmc1	A	G	19: 20,940,903		probably null	Het
Tnc	A	G	4: 63,984,589	F1484L	probably benign	Het
Tnfsf13	T	A	11: 69,685,132		probably null	Het
Tnrc6c	T	A	11: 117,733,618	S919T	probably damaging	Het
Trim17	C	A	11: 58,968,616	Q219K	probably benign	Het
Trim5	T	A	7: 104,265,668	H389L	probably benign	Het
Trio	T	A	15: 27,805,654	M583L	possibly damaging	Het
Ttll10	A	T	4: 156,035,801	H389Q	possibly damaging	Het
Vmn1r19	T	A	6: 57,404,490	Y9*	probably null	Het
Vmn2r50	T	A	7: 10,047,612	D402V	probably damaging	Het
Vmn2r93	C	A	17: 18,313,286	A484E	probably benign	Het
Vps13a	T	C	19: 16,664,664	T2200A	probably benign	Het
Wdr36	T	A	18: 32,841,905	H103Q	probably benign	Het
Zfp534	G	A	4: 147,675,210	T334I	possibly damaging	Het
Zfp804b	C	T	5: 6,770,372	S897N	probably benign	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGACGCCTTTTAACGGACTTC -3'
(R):5'- GATGTAGCTCCTCTTGACCG -3'

Sequencing Primer
(F):5'- GACGCCTTTTAACGGACTTCTCTTAC -3'
(R):5'- TACGCGTCACTGAGGATGG -3'

Posted On

2019-05-13