Incidental Mutation 'R7403:Usp24'
ID574330
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106407035 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1721 (D1721G)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094933
AA Change: D1720G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: D1720G

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165709
AA Change: D1721G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: D1721G

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 intron probably null
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7983:Usp24 UTSW 4 106409400 missense probably damaging 1.00
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCAGGCAGTATTCTGAGAC -3'
(R):5'- TCTGACAAGCTGTTAGTGATGAG -3'

Sequencing Primer
(F):5'- GCAGGCAGTATTCTGAGACTATTCC -3'
(R):5'- GCTGTTAGTGATGAGAGAAAACC -3'
Posted On2019-09-13