Incidental Mutation 'R7231:Ralgapa1'
ID562492
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R7231 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55604191 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2060 (S2060P)
Ref Sequence ENSEMBL: ENSMUSP00000151498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051857] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably benign
Transcript: ENSMUST00000051857
SMART Domains Protein: ENSMUSP00000061046
Gene: ENSMUSG00000045440

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 61 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 119 136 N/A INTRINSIC
ZnF_C2H2 203 223 1.98e2 SMART
ZnF_C2H2 231 253 7.15e-2 SMART
low complexity region 341 349 N/A INTRINSIC
ZnF_C2H2 354 376 1.2e-3 SMART
ZnF_C2H2 398 420 1.02e1 SMART
low complexity region 433 448 N/A INTRINSIC
ZnF_C2H2 452 475 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
Predicted Effect probably benign
Transcript: ENSMUST00000219451
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: S2060P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226244
AA Change: S2516P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Asxl3 A G 18: 22,517,540 E862G probably damaging Het
Asxl3 A T 18: 22,411,499 probably null Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Cyp4a32 T C 4: 115,609,697 L193P probably damaging Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fbln1 T C 15: 85,206,152 S7P unknown Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Ppp2r5d A T 17: 46,684,060 Y572N probably benign Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Slc9a3r2 C T 17: 24,650,104 R16H probably damaging Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zc3h3 C T 15: 75,840,382 V77M probably damaging Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGAGTGTTATGGCAAAC -3'
(R):5'- GCTTTGGGGAACAGCAAGTC -3'

Sequencing Primer
(F):5'- GTGTTATGGCAAACACGCG -3'
(R):5'- AGGATCCTACCCAGAGAT -3'
Posted On2019-06-26