Mutagenetix > Incidental Mutation

Incidental Mutation 'R7231:Ralgapa1'

562492

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

045342-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R7231 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55604191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2060 (S2060P)

Ref Sequence

ENSEMBL: ENSMUSP00000151498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051857] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably benign
Transcript: ENSMUST00000051857

SMART Domains

Protein: ENSMUSP00000061046
Gene: ENSMUSG00000045440

Domain	Start	End	E-Value	Type
low complexity region	21	31	N/A	INTRINSIC
low complexity region	61	78	N/A	INTRINSIC
low complexity region	97	114	N/A	INTRINSIC
low complexity region	119	136	N/A	INTRINSIC
ZnF_C2H2	203	223	1.98e2	SMART
ZnF_C2H2	231	253	7.15e-2	SMART
low complexity region	341	349	N/A	INTRINSIC
ZnF_C2H2	354	376	1.2e-3	SMART
ZnF_C2H2	398	420	1.02e1	SMART
low complexity region	433	448	N/A	INTRINSIC
ZnF_C2H2	452	475	4.11e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085385

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110687

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219432

Predicted Effect

probably benign
Transcript: ENSMUST00000219451

Predicted Effect

probably damaging
Transcript: ENSMUST00000220367
AA Change: S2060P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226244
AA Change: S2516P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,294,175	T2013S	probably benign	Het
Ablim3	A	G	18: 61,805,064		probably null	Het
Acvrl1	T	A	15: 101,136,223	C206*	probably null	Het
Adamts15	C	A	9: 30,906,158	R541S	probably damaging	Het
Add3	A	G	19: 53,233,146	I230V	probably benign	Het
Ankrd27	A	G	7: 35,628,446	D742G	possibly damaging	Het
Asxl3	A	T	18: 22,411,499		probably null	Het
Asxl3	A	G	18: 22,517,540	E862G	probably damaging	Het
Atp2b2	G	A	6: 113,765,732	T798M	possibly damaging	Het
Car12	T	C	9: 66,752,317	I208T	probably damaging	Het
Cgn	T	A	3: 94,773,192	Q600L	probably damaging	Het
Cgnl1	C	T	9: 71,632,645	A1106T	probably benign	Het
Cmtr2	T	C	8: 110,222,546	V496A	probably benign	Het
Cplx4	C	A	18: 65,957,052	D99Y	probably damaging	Het
Cyfip2	T	C	11: 46,224,136	T915A	probably benign	Het
Cyp4a32	T	C	4: 115,609,697	L193P	probably damaging	Het
Dennd5b	C	T	6: 149,044,604	R503Q	probably damaging	Het
Depdc5	C	A	5: 32,901,865	Q303K	possibly damaging	Het
Dlx1	T	A	2: 71,532,496	M249K	possibly damaging	Het
Dnah10	A	T	5: 124,813,828	E3218V	probably benign	Het
Dnah9	T	C	11: 65,965,647	D2896G	probably damaging	Het
Dtx4	C	A	19: 12,469,658	G557*	probably null	Het
Eps8l2	A	G	7: 141,360,392	N512D	probably damaging	Het
Fam20a	T	C	11: 109,721,375	D114G	possibly damaging	Het
Fbln1	T	C	15: 85,206,152	S7P	unknown	Het
Fli1	T	C	9: 32,424,188	E316G	probably damaging	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Haus8	G	A	8: 71,253,137	T302I	probably benign	Het
Hmcn1	T	C	1: 150,638,876	I3582V	probably benign	Het
Hnrnpul1	G	A	7: 25,748,417	Q161*	probably null	Het
Hsf4	C	T	8: 105,272,147	A223V	probably damaging	Het
Ighg2c	A	G	12: 113,288,016	W164R		Het
Isl1	A	G	13: 116,303,290	V174A	probably benign	Het
Itih4	A	T	14: 30,896,614	I661F	probably benign	Het
Klhl14	A	T	18: 21,652,136	L78Q	probably damaging	Het
L3mbtl3	T	A	10: 26,339,282	I177F	unknown	Het
Lingo3	T	A	10: 80,835,104	T331S	possibly damaging	Het
Lrrc36	T	C	8: 105,461,057	V535A	possibly damaging	Het
Mapk8ip2	T	G	15: 89,458,076	S497A	probably benign	Het
Mbip	A	G	12: 56,337,762		probably null	Het
Nelfa	C	T	5: 33,898,825	G498D	probably damaging	Het
Nlrc5	T	A	8: 94,521,805		probably null	Het
Olfr1312	A	T	2: 112,042,366	V222D	probably damaging	Het
Olfr679	T	C	7: 105,085,787	S24P	possibly damaging	Het
Olfr701	A	T	7: 106,818,443	Y120F	probably damaging	Het
Olfr863-ps1	T	A	9: 19,941,559	T294S	unknown	Het
Pde2a	A	G	7: 101,505,953	Y567C	probably damaging	Het
Pdia4	A	T	6: 47,800,957	F367Y	probably benign	Het
Pkdrej	C	A	15: 85,816,188	C1849F	possibly damaging	Het
Plekhj1	T	G	10: 80,797,658	T52P	probably damaging	Het
Ppp2r5d	A	T	17: 46,684,060	Y572N	probably benign	Het
Prkcq	T	A	2: 11,290,451	Y570*	probably null	Het
Ptpn3	T	A	4: 57,245,062	D226V	probably damaging	Het
Rab1b	A	G	19: 5,105,201	S22P	probably damaging	Het
Rnf148	G	T	6: 23,654,891	S35R	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Samd15	T	A	12: 87,201,044	S168T	possibly damaging	Het
Slc26a4	T	A	12: 31,547,946	N167I	probably damaging	Het
Slc39a1	C	A	3: 90,251,790	H141Q	probably benign	Het
Slc9a3r2	C	T	17: 24,650,104	R16H	probably damaging	Het
Snx21	T	C	2: 164,786,201	S46P	probably benign	Het
Strip2	A	G	6: 29,944,487	S657G	probably damaging	Het
Stxbp3	G	A	3: 108,800,809	P392L	probably damaging	Het
Suclg1	G	A	6: 73,263,971	R161H	probably benign	Het
Tas1r3	T	C	4: 155,862,826	Y134C	probably damaging	Het
Tgif1	T	A	17: 70,846,173	Q114L	probably damaging	Het
Tll2	A	G	19: 41,086,234	F964L	probably benign	Het
Tmem181a	T	C	17: 6,297,920	S247P	possibly damaging	Het
Trav23	A	T	14: 53,977,568	R79S	probably damaging	Het
Trf	C	A	9: 103,225,148	C177F	probably damaging	Het
Triml1	T	C	8: 43,136,371	Y260C	probably benign	Het
Tulp4	T	C	17: 6,236,235	F1513L	probably benign	Het
Umodl1	G	A	17: 30,986,116	V562I	probably damaging	Het
Ush2a	A	G	1: 188,759,763	K3083R	possibly damaging	Het
Vmn1r74	A	T	7: 11,846,961	I63F	probably benign	Het
Vmn2r38	C	T	7: 9,097,638	C43Y	possibly damaging	Het
Vmn2r50	A	T	7: 10,053,083	N32K	probably benign	Het
Vps13d	A	G	4: 145,057,462	V3914A		Het
Vwa5b2	A	G	16: 20,604,128	T984A	probably benign	Het
Zc3h3	C	T	15: 75,840,382	V77M	probably damaging	Het
Zfp397	A	T	18: 23,960,358	H300L	probably damaging	Het
Zfp950	G	A	19: 61,119,212	R478C	probably benign	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATGAGTGTTATGGCAAAC -3'
(R):5'- GCTTTGGGGAACAGCAAGTC -3'

Sequencing Primer
(F):5'- GTGTTATGGCAAACACGCG -3'
(R):5'- AGGATCCTACCCAGAGAT -3'

Posted On

2019-06-26