Incidental Mutation 'R7535:Usp36'
ID583537
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Nameubiquitin specific peptidase 36
Synonyms2700002L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location118259651-118290244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118262046 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1084 (S1084T)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092382
AA Change: S1084T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: S1084T

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106296
AA Change: S1084T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: S1084T

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144153
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118264820 missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118285960 missense probably damaging 1.00
IGL01720:Usp36 APN 11 118275002 missense probably damaging 0.99
IGL02410:Usp36 APN 11 118276185 missense probably damaging 1.00
IGL02700:Usp36 APN 11 118276157 missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118264783 missense probably benign 0.22
IGL03145:Usp36 APN 11 118279241 missense probably damaging 1.00
IGL03203:Usp36 APN 11 118285810 missense probably benign 0.42
IGL03265:Usp36 APN 11 118264809 missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118265194 missense probably benign 0.21
R0499:Usp36 UTSW 11 118273571 missense probably damaging 0.98
R0606:Usp36 UTSW 11 118263028 splice site probably benign
R0646:Usp36 UTSW 11 118273021 missense probably damaging 1.00
R1579:Usp36 UTSW 11 118284945 missense probably damaging 1.00
R1646:Usp36 UTSW 11 118273566 missense probably damaging 1.00
R1716:Usp36 UTSW 11 118272131 critical splice donor site probably null
R1886:Usp36 UTSW 11 118272958 missense probably damaging 1.00
R2014:Usp36 UTSW 11 118262508 splice site probably benign
R2068:Usp36 UTSW 11 118275018 missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118268665 missense probably benign 0.02
R2191:Usp36 UTSW 11 118285023 missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118276756 splice site probably benign
R3176:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3177:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3276:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3277:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3615:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3616:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3768:Usp36 UTSW 11 118263052 missense probably damaging 1.00
R3899:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118285795 missense probably damaging 0.99
R4809:Usp36 UTSW 11 118263070 missense probably damaging 1.00
R5135:Usp36 UTSW 11 118264905 missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118265194 missense probably benign 0.21
R6226:Usp36 UTSW 11 118277274 missense probably damaging 1.00
R6266:Usp36 UTSW 11 118268585 missense probably damaging 1.00
R7191:Usp36 UTSW 11 118268834 missense probably benign 0.39
R7215:Usp36 UTSW 11 118265154 missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118273529 missense probably damaging 1.00
R7675:Usp36 UTSW 11 118263696 missense probably benign 0.11
R7843:Usp36 UTSW 11 118285965 missense probably damaging 1.00
R8228:Usp36 UTSW 11 118264890 missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118275014 missense probably damaging 1.00
R8935:Usp36 UTSW 11 118276831 critical splice acceptor site probably null
X0020:Usp36 UTSW 11 118273613 missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118276200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACGCCAGATATACACATATGAG -3'
(R):5'- GCAAATAGGGATGGGACCTC -3'

Sequencing Primer
(F):5'- GCCAGATATACACATATGAGCTAAC -3'
(R):5'- CATCAGAGGGCGCCATACATG -3'
Posted On2019-10-17