Incidental Mutation 'R7353:Zmpste24'
ID 570722
Institutional Source Beutler Lab
Gene Symbol Zmpste24
Ensembl Gene ENSMUSG00000043207
Gene Name zinc metallopeptidase, STE24
Synonyms A530043O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 121059237-121098241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121095581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 81 (S81P)
Ref Sequence ENSEMBL: ENSMUSP00000053900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058754] [ENSMUST00000135788]
AlphaFold Q80W54
Predicted Effect probably damaging
Transcript: ENSMUST00000058754
AA Change: S81P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207
AA Change: S81P

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135788
AA Change: S40P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122588
Gene: ENSMUSG00000043207
AA Change: S40P

DomainStartEndE-ValueType
PDB:2YPT|E 1 146 5e-58 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are deficient in proteolytic processing of prelamin A and display many abnormalities including retarded growth, bone fragility, hair loss, cardiomyopathy, muscular dystrophy and lipodystrophy. Most die prematurely, but some survive and reproduce. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Zmpste24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Zmpste24 APN 4 121082815 unclassified probably benign
IGL00672:Zmpste24 APN 4 121065860 missense probably damaging 1.00
IGL00828:Zmpste24 APN 4 121074520 missense possibly damaging 0.66
IGL01731:Zmpste24 APN 4 121097884 missense probably benign
IGL01738:Zmpste24 APN 4 121061111 missense probably damaging 1.00
IGL02668:Zmpste24 APN 4 121061100 missense probably damaging 1.00
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0226:Zmpste24 UTSW 4 121081209 missense probably benign 0.00
R0277:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R0323:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R1822:Zmpste24 UTSW 4 121087316 missense possibly damaging 0.78
R2233:Zmpste24 UTSW 4 121097965 missense probably benign 0.05
R2374:Zmpste24 UTSW 4 121074537 missense probably benign
R3683:Zmpste24 UTSW 4 121061091 missense probably damaging 1.00
R4810:Zmpste24 UTSW 4 121061054 missense probably damaging 1.00
R5169:Zmpste24 UTSW 4 121068717 missense probably damaging 1.00
R5650:Zmpste24 UTSW 4 121082877 missense possibly damaging 0.67
R5709:Zmpste24 UTSW 4 121065878 missense probably benign
R6429:Zmpste24 UTSW 4 121095670 missense probably damaging 0.99
R7165:Zmpste24 UTSW 4 121082894 missense probably null 1.00
R7498:Zmpste24 UTSW 4 121082831 missense probably benign 0.00
R8416:Zmpste24 UTSW 4 121083359 missense probably benign 0.42
R8958:Zmpste24 UTSW 4 121087311 nonsense probably null
R9138:Zmpste24 UTSW 4 121065821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTCCATCTGCAATGCTG -3'
(R):5'- CAAATTAATGCTACAGACCATTCGG -3'

Sequencing Primer
(F):5'- TGGCGCATACACCATTGATG -3'
(R):5'- CCATTCGGTGTTTGATCACAAATTAC -3'
Posted On 2019-09-13