Mutagenetix > Incidental Mutations

Incidental Mutation 'R7353:Zmpste24'

570722

Institutional Source

Beutler Lab

Gene Symbol

Zmpste24

Ensembl Gene

ENSMUSG00000043207

Gene Name

zinc metallopeptidase, STE24

Synonyms

A530043O15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121059237-121098241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121095581 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 81 (S81P)

Ref Sequence

ENSEMBL: ENSMUSP00000053900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058754] [ENSMUST00000135788]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058754
AA Change: S81P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207
AA Change: S81P

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M48_N	41	225	2.5e-70	PFAM
Pfam:Peptidase_M48	228	473	5.5e-75	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000135788
AA Change: S40P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122588
Gene: ENSMUSG00000043207
AA Change: S40P

Domain	Start	End	E-Value	Type
PDB:2YPT\|E	1	146	5e-58	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are deficient in proteolytic processing of prelamin A and display many abnormalities including retarded growth, bone fragility, hair loss, cardiomyopathy, muscular dystrophy and lipodystrophy. Most die prematurely, but some survive and reproduce. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Zmpste24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00671:Zmpste24	APN	4	121082815	unclassified	probably benign
IGL00672:Zmpste24	APN	4	121065860	missense	probably damaging	1.00
IGL00828:Zmpste24	APN	4	121074520	missense	possibly damaging	0.66
IGL01731:Zmpste24	APN	4	121097884	missense	probably benign
IGL01738:Zmpste24	APN	4	121061111	missense	probably damaging	1.00
IGL02668:Zmpste24	APN	4	121061100	missense	probably damaging	1.00
R0097:Zmpste24	UTSW	4	121095543	splice site	probably benign
R0097:Zmpste24	UTSW	4	121095543	splice site	probably benign
R0226:Zmpste24	UTSW	4	121081209	missense	probably benign	0.00
R0277:Zmpste24	UTSW	4	121082853	missense	probably damaging	1.00
R0323:Zmpste24	UTSW	4	121082853	missense	probably damaging	1.00
R1822:Zmpste24	UTSW	4	121087316	missense	possibly damaging	0.78
R2233:Zmpste24	UTSW	4	121097965	missense	probably benign	0.05
R2374:Zmpste24	UTSW	4	121074537	missense	probably benign
R3683:Zmpste24	UTSW	4	121061091	missense	probably damaging	1.00
R4810:Zmpste24	UTSW	4	121061054	missense	probably damaging	1.00
R5169:Zmpste24	UTSW	4	121068717	missense	probably damaging	1.00
R5650:Zmpste24	UTSW	4	121082877	missense	possibly damaging	0.67
R5709:Zmpste24	UTSW	4	121065878	missense	probably benign
R6429:Zmpste24	UTSW	4	121095670	missense	probably damaging	0.99
R7165:Zmpste24	UTSW	4	121082894	missense	probably null	1.00
R7498:Zmpste24	UTSW	4	121082831	missense	probably benign	0.00
R8416:Zmpste24	UTSW	4	121083359	missense	probably benign	0.42
R8958:Zmpste24	UTSW	4	121087311	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGGTCCATCTGCAATGCTG -3'
(R):5'- CAAATTAATGCTACAGACCATTCGG -3'

Sequencing Primer
(F):5'- TGGCGCATACACCATTGATG -3'
(R):5'- CCATTCGGTGTTTGATCACAAATTAC -3'

Posted On

2019-09-13