Incidental Mutation 'R7353:Lctl'
ID 570745
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Name lactase-like
Synonyms KLPH, E130104I05Rik
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 64024429-64045400 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64034249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 296 (G296D)
Ref Sequence ENSEMBL: ENSMUSP00000034969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000124020]
AlphaFold Q8K1F9
Predicted Effect probably damaging
Transcript: ENSMUST00000034969
AA Change: G296D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: G296D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118215
AA Change: G137D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401
AA Change: G137D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124020
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64,040,411 (GRCm39) nonsense probably null
IGL03066:Lctl APN 9 64,025,017 (GRCm39) start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64,042,130 (GRCm39) unclassified probably benign
R0077:Lctl UTSW 9 64,029,389 (GRCm39) start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64,024,980 (GRCm39) utr 5 prime probably benign
R0335:Lctl UTSW 9 64,026,169 (GRCm39) missense probably benign 0.00
R0391:Lctl UTSW 9 64,029,596 (GRCm39) splice site probably benign
R1740:Lctl UTSW 9 64,040,389 (GRCm39) missense probably damaging 1.00
R1866:Lctl UTSW 9 64,039,003 (GRCm39) missense probably damaging 1.00
R2160:Lctl UTSW 9 64,025,049 (GRCm39) missense probably benign 0.02
R2867:Lctl UTSW 9 64,045,150 (GRCm39) missense probably benign 0.23
R2867:Lctl UTSW 9 64,045,150 (GRCm39) missense probably benign 0.23
R3605:Lctl UTSW 9 64,040,475 (GRCm39) missense probably damaging 1.00
R3607:Lctl UTSW 9 64,040,475 (GRCm39) missense probably damaging 1.00
R4585:Lctl UTSW 9 64,038,882 (GRCm39) missense probably damaging 1.00
R4861:Lctl UTSW 9 64,027,045 (GRCm39) missense possibly damaging 0.55
R4861:Lctl UTSW 9 64,027,045 (GRCm39) missense possibly damaging 0.55
R5249:Lctl UTSW 9 64,045,196 (GRCm39) missense probably benign
R7021:Lctl UTSW 9 64,040,075 (GRCm39) splice site probably null
R7106:Lctl UTSW 9 64,040,119 (GRCm39) missense probably benign 0.22
R7221:Lctl UTSW 9 64,026,217 (GRCm39) nonsense probably null
R7265:Lctl UTSW 9 64,034,203 (GRCm39) missense probably damaging 1.00
R7501:Lctl UTSW 9 64,038,861 (GRCm39) missense probably benign 0.00
R7615:Lctl UTSW 9 64,029,392 (GRCm39) missense probably damaging 1.00
R7855:Lctl UTSW 9 64,040,498 (GRCm39) missense possibly damaging 0.89
R9077:Lctl UTSW 9 64,039,241 (GRCm39) intron probably benign
R9318:Lctl UTSW 9 64,026,539 (GRCm39) intron probably benign
R9320:Lctl UTSW 9 64,040,455 (GRCm39) missense probably damaging 1.00
R9351:Lctl UTSW 9 64,040,473 (GRCm39) missense possibly damaging 0.94
R9552:Lctl UTSW 9 64,025,049 (GRCm39) missense probably benign 0.02
RF014:Lctl UTSW 9 64,026,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCATATCCTGCCTCTCC -3'
(R):5'- AGCCCAATAAATATGTGCTGTTT -3'

Sequencing Primer
(F):5'- CCTACCCTGACTTTCTTCCTTTAAGG -3'
(R):5'- GCATGGTGGCACATACTTGAATCC -3'
Posted On 2019-09-13