Incidental Mutation 'R7633:Dedd'
ID589736
Institutional Source Beutler Lab
Gene Symbol Dedd
Ensembl Gene ENSMUSG00000013973
Gene Namedeath effector domain-containing
SynonymsDEFT, CASP8IP1, KE05, FLDED1, Dedpro1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171329145-171342331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171338910 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 138 (P138L)
Ref Sequence ENSEMBL: ENSMUSP00000068419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064950] [ENSMUST00000097467] [ENSMUST00000111289] [ENSMUST00000111295] [ENSMUST00000111296] [ENSMUST00000111299] [ENSMUST00000111300] [ENSMUST00000127830] [ENSMUST00000129116] [ENSMUST00000135150] [ENSMUST00000142063] [ENSMUST00000156856] [ENSMUST00000157015]
Predicted Effect probably benign
Transcript: ENSMUST00000064950
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068419
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097467
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095075
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111289
SMART Domains Protein: ENSMUSP00000106920
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 191 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111295
SMART Domains Protein: ENSMUSP00000106926
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 6.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111296
SMART Domains Protein: ENSMUSP00000106927
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111299
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106930
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111300
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106931
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127830
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122628
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129116
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120278
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135150
Predicted Effect probably benign
Transcript: ENSMUST00000142063
AA Change: P138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120861
Gene: ENSMUSG00000013973
AA Change: P138L

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156856
SMART Domains Protein: ENSMUSP00000116835
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 131 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157015
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced body size, organ size and organ weight without reductions in cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Dedd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03105:Dedd APN 1 171340918 missense probably damaging 1.00
R0512:Dedd UTSW 1 171340930 missense probably damaging 1.00
R1225:Dedd UTSW 1 171340295 splice site probably null
R3815:Dedd UTSW 1 171338901 missense probably benign 0.11
R5386:Dedd UTSW 1 171338383 missense probably damaging 1.00
R6376:Dedd UTSW 1 171340222 missense probably benign 0.00
R7475:Dedd UTSW 1 171340313 missense probably benign 0.37
R7806:Dedd UTSW 1 171338494 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTTGACCTGGGGAATACC -3'
(R):5'- ACCTGCTTTATGTGTGTACATGTTC -3'

Sequencing Primer
(F):5'- TACCTAGGAGAACAGAGATCCTTTG -3'
(R):5'- CACAGGTCTTCATGAGTATGCAGC -3'
Posted On2019-10-24