Incidental Mutation 'R7633:C530008M17Rik'
ID589750
Institutional Source Beutler Lab
Gene Symbol C530008M17Rik
Ensembl Gene ENSMUSG00000036377
Gene NameRIKEN cDNA C530008M17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76656512-76873554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76857520 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 576 (E576G)
Ref Sequence ENSEMBL: ENSMUSP00000113796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120639] [ENSMUST00000121160] [ENSMUST00000163347]
Predicted Effect unknown
Transcript: ENSMUST00000120639
AA Change: E576G
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377
AA Change: E576G

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121160
AA Change: E576G
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377
AA Change: E576G

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163347
AA Change: E576G
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377
AA Change: E576G

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in C530008M17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:C530008M17Rik APN 5 76866056 unclassified probably benign
IGL00660:C530008M17Rik APN 5 76854933 critical splice acceptor site probably null
IGL00924:C530008M17Rik APN 5 76858986 missense unknown
IGL01025:C530008M17Rik APN 5 76658074 intron probably benign
IGL01122:C530008M17Rik APN 5 76870675 makesense probably null
IGL01393:C530008M17Rik APN 5 76858971 missense unknown
IGL01526:C530008M17Rik APN 5 76857631 missense unknown
IGL01986:C530008M17Rik APN 5 76858610 missense unknown
IGL02009:C530008M17Rik APN 5 76848970 missense possibly damaging 0.61
IGL02724:C530008M17Rik APN 5 76858459 missense unknown
IGL02869:C530008M17Rik APN 5 76859043 missense unknown
IGL03030:C530008M17Rik APN 5 76857616 missense unknown
IGL03150:C530008M17Rik APN 5 76867250 missense probably damaging 0.99
LCD18:C530008M17Rik UTSW 5 76658742 intron probably benign
R0975:C530008M17Rik UTSW 5 76856318 splice site probably benign
R1329:C530008M17Rik UTSW 5 76657932 intron probably benign
R1439:C530008M17Rik UTSW 5 76840910 missense probably damaging 0.99
R1750:C530008M17Rik UTSW 5 76857675 missense unknown
R1773:C530008M17Rik UTSW 5 76867205 missense possibly damaging 0.54
R1885:C530008M17Rik UTSW 5 76856742 missense unknown
R1924:C530008M17Rik UTSW 5 76858623 missense unknown
R2483:C530008M17Rik UTSW 5 76856409 missense probably damaging 0.98
R3840:C530008M17Rik UTSW 5 76859011 missense unknown
R3841:C530008M17Rik UTSW 5 76859011 missense unknown
R3874:C530008M17Rik UTSW 5 76840892 missense probably damaging 1.00
R3883:C530008M17Rik UTSW 5 76856574 missense unknown
R4033:C530008M17Rik UTSW 5 76858465 missense unknown
R4401:C530008M17Rik UTSW 5 76848916 missense probably damaging 0.98
R4749:C530008M17Rik UTSW 5 76858834 missense unknown
R4884:C530008M17Rik UTSW 5 76848835 missense probably damaging 1.00
R4980:C530008M17Rik UTSW 5 76857574 missense unknown
R5010:C530008M17Rik UTSW 5 76657834 utr 5 prime probably benign
R5086:C530008M17Rik UTSW 5 76857124 missense unknown
R5468:C530008M17Rik UTSW 5 76840763 intron probably benign
R5786:C530008M17Rik UTSW 5 76866196 splice site probably null
R5813:C530008M17Rik UTSW 5 76858428 missense unknown
R5866:C530008M17Rik UTSW 5 76857537 missense unknown
R5928:C530008M17Rik UTSW 5 76841734 intron probably benign
R6273:C530008M17Rik UTSW 5 76857721 missense unknown
R6577:C530008M17Rik UTSW 5 76866100 unclassified probably benign
R6838:C530008M17Rik UTSW 5 76858209 missense unknown
R6849:C530008M17Rik UTSW 5 76857010 missense unknown
R6849:C530008M17Rik UTSW 5 76857157 missense unknown
R6914:C530008M17Rik UTSW 5 76857007 missense unknown
R7017:C530008M17Rik UTSW 5 76856948 small deletion probably benign
R7094:C530008M17Rik UTSW 5 76859032 missense unknown
R7367:C530008M17Rik UTSW 5 76856602 missense unknown
R7394:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7436:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7443:C530008M17Rik UTSW 5 76856638 missense unknown
R7500:C530008M17Rik UTSW 5 76658058 missense unknown
R7566:C530008M17Rik UTSW 5 76866275 splice site probably null
R7728:C530008M17Rik UTSW 5 76857469 missense unknown
R7930:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7985:C530008M17Rik UTSW 5 76658050 missense unknown
R8154:C530008M17Rik UTSW 5 76841797 missense unknown
R8463:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R8547:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R8805:C530008M17Rik UTSW 5 76858642 missense unknown
R8819:C530008M17Rik UTSW 5 76856946 small deletion probably benign
Z1176:C530008M17Rik UTSW 5 76857246 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACGGACGATGCTGACCAG -3'
(R):5'- ACCAAAATGGCCGTGTGTG -3'

Sequencing Primer
(F):5'- CGGGACCTTGAGAAGCCAG -3'
(R):5'- TTACCGGGCTCAGGTTGAC -3'
Posted On2019-10-24